Overview

Comprehensive Description

Biology

Occurs in quiet pools and runs over sand, silt, or gravel, in small to large rivers. Most common in medium-sized rivers (Ref. 5723, 10294). Feeds on insect immatures (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Mississippi River basin from western Pennsylvania to Minnesota and south to the Gulf; Gulf Slope drainages from Mobile Bay, Georgia and Alabama, to Rio Grande, Texas, New Mexico, and Mexico; population in upper Rio Grande, New Mexico and western Texas, may have been introduced; common over much of range, locally abundant (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Mississippi River basin from western Pennsylvania to Minnesota and south to the Gulf; Gulf Slope drainages from Mobile Bay, Georgia and Alabama, to Rio Grande, Texas, New Mexico, and Mexico; population in upper Rio Grande, New Mexico and western Texas, may have been introduced; common over much of range, locally abundant (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S.A. and northern Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Mississippi River basin from western Pennsylvania to Minnesota in USA, and south to Gulf; Gulf Slope drainages from Mobile Bay in Georgia and Alabama to Rio Grande in Texas and New Mexico, USA and Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 9 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 89 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.2 cm TL (male/unsexed; (Ref. 10294))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Pimephales vigilax
Catalog Number: USNM 30
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): C. Kennerly
Locality: Leon River, Texas, Texas, United States, North America
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Pimephales vigilax
Catalog Number: USNM 150
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): S. Van Vliet
Year Collected: 1852
Locality: Brownsville,Texas., Cameron County, Texas, United States, North America
  • Syntype: Baird, S. F. & Girard, C. F. 1854. Proceedings of the Academy of Natural Sciences of Philadelphia. 7: 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Pimephales vigilax
Catalog Number: USNM 29
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): C. Kennerly
Locality: San Pedro Cr., Texas., Texas, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Pools, backwaters, and quiet runs of small to large rivers having continuous flow and low to moderate gradient, over sand, silt, or gravel; most common in medium-sized rivers; also in some reservoirs; tolerant of turbidity; avoids rapid currents; in Guadalupe drainage, Texas, greatest numbers were at upstream end of silty pools (Sublette et al. 1990). Spawns under flat stones or debris in shallow pools or slowly flowing water, in nest constructed and guarded by male (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Pools, backwaters, and quiet runs of small to large rivers having continuous flow and low to moderate gradient, over sand, silt, or gravel; most common in medium-sized rivers; also in some reservoirs; tolerant of turbidity; avoids rapid currents; in Guadalupe drainage, Texas, greatest numbers were at upstream end of silty pools (Sublette et al. 1990). Spawns under flat stones or debris in shallow pools or slowly flowing water, in nest constructed and guarded by male (Becker 1983).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 3 taxa.

Environmental ranges
  Depth range (m): 0.5 - 0.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic omnivore; diet may be mainly algae or aquatic invertebrates or a combination of both (Becker 1983). Primarily insectivorous, feeding on or near bottom on chironomid and trichopteran larvae, also taking other invertebrates and detritus (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Schools in daytime, disperses at night when resting.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in late spring and summer. Eggs guarded by male, hatch in 4-6 days at 26-28 C. Sexually mature at age I (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pimephales vigilax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCTTTAAGCCTCCTAATTCGCGCTGAGCTAAGTCAACCTGGCTCACTTCTAGGGGATGACCAAATCTATAATGTTATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTCTTATTGGTGGGTTCGGAAACTGACTTGTACCTCTAATAATTGGCGCACCAGATATAGCATTTCCACGAATAAATAACATAAGCTTCTGACTTTTACCCCCATCATTTCTACTACTGTTAGCCTCTTCTGGTGTCGAAGCCGGAGCCGGGACAGGATGAACTGTCTACCCCCCACTTGCAGGTAATCTTGCCCACGCAGGAGCATCAGTAGACCTTACAATCTTCTCTTTACATTTAGCAGGTGTATCATCAATTTTAGGGGCAGTTAATTTTATCACTACAATTATTAATATGAAACCCCCAGCAATCTCTCAATATCAAACACCCCTCTTCGTATGAGCAGTACTTGTTACTGCAGTGCTTCTACTCCTATCATTACCTGTCCTAGCCGCCGGAATTACTATACTTCTTACTGATCGTAATTTAAATACCACATTTTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATACCAACANNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pimephales vigilax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pimephales vigilax

Pimephales vigilax, also known as the bullhead minnow, is a species of freshwater demersal fish,[1] native to the Southern United States.

History[edit]

The Bullhead Minnow was first described by Spencer Baird and Charles Girard in 1853.

Characteristics[edit]

The Bullhead Minnow is cylindrical and small in size, ranging from 43 to 102 mm in length and the average length being 50 mm.[2] The males of the species are dark in color, brown, olive, or tan, with two light colored vertical lines down their side, while the females are plain in comparison. The snout is rounded, and no teeth are present.[3] The tail is forked with rounded ends, the single dorsal fin contains eight rays and no spine, the anal fin contains seven rays with no spine, pelvic fins are abdominal and no adipose fin is present.[4]

Distribution[edit]

The Bullhead Minnow is mainly located in the Southern United States, in the Gulf Coast of the United States and Mississippi River Basin. It can be found in less majority throughout the entire Mississippi River, as well as connected brooks, streams, ponds, lakes, and rivers.[3] They are found more often in waters that typically have little to no movement, such as in river pools.[5] It is one of the 324 fish species found in Tennessee.[6]

Biology[edit]

The spawning season extends from the middle of May through early September. They reproduce in an egg-clustering fashion. For a mating location, the males build a nest, normally protected by rocks, tree roots or limbs, or boards, The female lays eggs in the nest, and the male guards the eggs throughout spawning. There is currently no known age of maturation for this fish. They live an average of three to five years. They are a bottom-living species, and feed on organisms found in the mud covering the ground.[7]

Human Uses[edit]

This minnow is commonly used in aquatic taxology. They are also sold as bait fish and fed to aquarium-living fish.[2]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2011). "Pimephales vigilax" in FishBase. July 2011 version.
  2. ^ a b Pimephales promelas”. Marinco Bioassay Laboratory Inc., 2005
  3. ^ a b ”Bullhead Minnow”. Official Web site of Alabama Department of Conservation and Natural Resources, 2008
  4. ^ “Bullhead Minnow”. University of Wisconsin Sea Grant Institute, 2013
  5. ^ http://wildlife.ohiodnr.gov/species-and-habitats/species-guide-index/fish/bullhead-minnow
  6. ^ http://www.bio.utk.edu/hulseylab/Fishlist.html
  7. ^ "Pimephales Vigilax: Bullhead Minnow". Retrieved 27 March 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: NOR chromosomal data support monophyly of the four extant species of Pimephales and suggest that the genus Pimephales belongs in a monophyletic assemblage with, among others, the cyprinid genera Cyprinella and Opsopoeodus (Li and Gold 1991); Coburn and Cavender (1992) also indicated that these three genera are phylogenetically closely related.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!