Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Common species (Ref. 34024). Found between depths of 22 m (Ref. 58489) and 1000 m (Ref. 33848). Feed mainly on crustaceans such as Munida and scampi and also on fish. Also caught above the bottom when feeding on hoki (Macruronus novaezelandiae) during the hoki spawning season. Available all year round. Juveniles are found in shallower shelf waters (Ref. 6390). Oviparous, with oval pelagic eggs floating in a gelatinous mass (Ref. 205). Utilized fresh, frozen or smoked; can be fried and baked (Ref. 9988, 34024).
  • Nielsen, J.G., D.M. Cohen, D.F. Markle and C.R. Robins 1999 Ophidiiform fishes of the world (Order Ophidiiformes). An annotated and illustrated catalogue of pearlfishes, cusk-eels, brotulas and other ophidiiform fishes known to date. FAO Fish. Synop. 125(18):178p. Rome: FAO. (Ref. 34024)   http://www.fishbase.org/references/FBRefSummary.php?id=34024&speccode=65 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southwest Pacific: southern Australia and around New Zealand. Southeast Pacific: Chile (Ref. 9068). Southwest Atlantic: Brazil (Ref. 4517).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South America and Australia and New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 141 - 164; Analspines: 0; Analsoft rays: 101 - 126; Vertebrae: 68 - 70
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

200 cm SL (male/unsexed; (Ref. 34024)); max. published weight: 25.0 kg (Ref. 34024); max. reported age: 30 years (Ref. 9072)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body pinkish yellow, marbled with irregular reddish brown blotches dorsally (Ref. 27363).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; oceanodromous (Ref. 51243); marine; depth range 22 - 1000 m (Ref. 58489), usually 300 - 550 m (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13615 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9570 samples.

Environmental ranges
  Depth range (m): 2 - 1308
  Temperature range (°C): 2.457 - 25.804
  Nitrate (umol/L): 0.908 - 35.638
  Salinity (PPS): 32.545 - 37.190
  Oxygen (ml/l): 3.879 - 7.093
  Phosphate (umol/l): 0.112 - 2.346
  Silicate (umol/l): 0.000 - 61.252

Graphical representation

Depth range (m): 2 - 1308

Temperature range (°C): 2.457 - 25.804

Nitrate (umol/L): 0.908 - 35.638

Salinity (PPS): 32.545 - 37.190

Oxygen (ml/l): 3.879 - 7.093

Phosphate (umol/l): 0.112 - 2.346

Silicate (umol/l): 0.000 - 61.252
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 800m.
From 20 to 800 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf and slope (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Genypterus blacodes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCTTAAGTCTCCTTATTCGGGCAGAACTAAGCCAACCCGGCGCTCTCCTAGGAGACGACCAAATTTATAACGTAATCGTAACAGCTCACGCCTTTGTTATGATTTTCTTCATAGTAATACCAATTATAATTGGCGGCTTCGGGAACTGACTAATTCCTCTTATGATCGGCGCCCCCGACATAGCATTCCCGCGAATAAACAACATAAGCTTCTGACTTCTCCCCCCTTCATTCCTTCTTCTCCTAGCTTCCTCTGGTGTAGAAGCCGGAGCGGGAACCGGTTGAACCGTTTACCCGCCCTTAGCAGGAAACCTCTCTCACGCCGGCCCTTCTGTTGACCTCACTATTTTTTCCCTACATCTAGCAGGAGTTTCGTCAATTTTAGGGGCCATTAACTTTATCACTACAATTATTAACATAAAACCCCCCGCCATTTCACAATACCAAACGCCCCTATTTGTCTGAGCAGTCCTAATCACGGCAGTCCTTCTATTACTTTCACTTCCAGTTCTTGCCGCAGGCATCACCATGCTTCTTACGGACCGAAACCTAAACACTACTTTCTTTGACCCTGCGGGAGGAGGAGACCCAATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Genypterus blacodes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: medium; price reliability: reliable: based on ex-vessel price for this species
  • Nielsen, J.G., D.M. Cohen, D.F. Markle and C.R. Robins 1999 Ophidiiform fishes of the world (Order Ophidiiformes). An annotated and illustrated catalogue of pearlfishes, cusk-eels, brotulas and other ophidiiform fishes known to date. FAO Fish. Synop. 125(18):178p. Rome: FAO. (Ref. 34024)   http://www.fishbase.org/references/FBRefSummary.php?id=34024&speccode=65 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pink cusk-eel

The pink cusk-eel, Genypterus blacodes, is a species of cusk-eel found in the oceans around southern Australia, Chile, Brazil, and around New Zealand except the east coast of Northland, in depths of 22 to 1,000 metres (72 to 3,300 ft). Their length is up to 200 centimetres (79 in), and they live for up to 30 years.

Other names in English include ling, Australian rockling, New Zealand ling, kingklip, pink ling, and northern ling. The South African kingklip is a similar, related species (Genypterus capensis).[1]

In the month-long NORFANZ Expedition of 2003 which was examining the biodiversity of the seamounts and slopes of the Norfolk Ridge near New Zealand, a single specimen weighing 6.3 kg (20 lb) was collected.[2]

References[edit]

  1. ^ "Kingklip / New Zealand Ling". SASSI Fish Info. Southern African Sustainable Seafood Initiative. Retrieved 2012-04-10. 
  2. ^ NORFANZ Voyage Retrieved 2011-10-29.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!