Overview

Comprehensive Description

Biology

Inhabits seaward reef slopes; occasionally on shallow patch reefs (Ref. 9710). Found in large midwater aggregations feeding on plankton (Ref. 9710), small jellyfishes, pteropods, pelagic tunicates and various invertebrate larvae (Ref. 13442). Form leks during breeding (Ref. 55367). Also caught with beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda, southern Florida (USA), and Bahamas to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found in the Western Atlantic from Bermuda, southern Florida (USA), and Bahamas to Venezuela and Trinidad and Tobago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 320 g (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Moderately elongate, compressed fish with equally curved upper and lower profiles (Ref. 26938). Color primarily violet or purple; large individuals with a wash of yellow on lower two-thirds of body; prolonged portions of dorsal and anal fins and tips of pelvic fins blackish (Ref. 13442). Caudal fin emarginate in young, lunate in adults (Ref 52831).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 8 - 100 m (Ref. 89896), usually ? - 40 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits outer reef areas and is most common at depths of 10-30 m, although it can occur to 40 m. It feeds planktivorously in aggregations off the bottom on copepods, jellyfishes, pteropods, tunicates and larvae. Of 41 reef fish species counted as a monitoring program in the Gulf of Mexico, Flower garden reserve was the most abundant (Precht et al. 2006).

This species is a small schooling wrasse that occurs in high densities in the near-reef pelagic zones. It is protogynous, monandric (Warner and Robertson 1978). It forms leks during breeding (Allsop and West 2003). Length at sex change = 15.78 cm TL (Allsop and West 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 5 - 47.5
  Temperature range (°C): 23.714 - 27.542
  Nitrate (umol/L): 0.336 - 1.844
  Salinity (PPS): 35.022 - 36.315
  Oxygen (ml/l): 4.517 - 4.687
  Phosphate (umol/l): 0.075 - 0.176
  Silicate (umol/l): 1.657 - 2.664

Graphical representation

Depth range (m): 5 - 47.5

Temperature range (°C): 23.714 - 27.542

Nitrate (umol/L): 0.336 - 1.844

Salinity (PPS): 35.022 - 36.315

Oxygen (ml/l): 4.517 - 4.687

Phosphate (umol/l): 0.075 - 0.176

Silicate (umol/l): 1.657 - 2.664
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 40m.
From 1 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Cleaned by Pederson's cleaner shrimp (Periclimenes pedersoni), goby (Gobiosoma evelynae and others), hogfish (Bodianus rufus), and also wrasse (Thalassoma trifasciata) as observed on the coral reefs in Bonaire, Netherlands Antilles (Ref. 36810).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

DMS in the odor landscape of the sea

Dimethyl Sulfide or DMS is present throughout the ocean(1). It’s an important odor component of many fish and shellfish, including clams, mussels, oysters, scallops, crabs and shrimp(2-9). Where does it come from? Usually from the marine plants they feed on.

Many species of plants and algae produce DMS, but not all species produce significant amounts of it. Nearly all of these are marine, and they tend to be in closely related groups with other DMS-producers, including Chlorophyte (green) seaweeds, the Dinophyceae in the dinoflagellates, and some members of the Chrysophyceae and the Bacillariophyceae (two classes of diatoms). Other large groups, like cyanobacteria and freshwater algae, tend not to produce DMS. (10,11)

Why do these groups produce DMS? In algae, most researchers believe a related chemical, DMSP, is used by the algae for osmoregulation- by ensuring the ion concentration inside their cells stays fairly close to the salinity in the seawater outside, they prevent osmotic shock. Otherwise, after a sudden exposure to fresh water (rain at the sea surface, for instance) cells could swell up and explode. In vascular plants, like marsh grasses and sugar cane, it’s not clear what DMS is used for. (12,13)

Freshly harvested shellfish can smell like DMS because DMSP has accumulated in their tissue from the algae in their diet. Some animals, including giant Tridacna clams and the intertidal flatworm Convoluta roscoffensis, harbor symbiotic algae in their tissues, which produce DMSP; this may not be important to their symbioses, but for Tridacna, the high DMS levels can be a problem for marketing the clams to human consumers. After death, DMSP begins to break down into DMS. A little DMS creates a pleasant flavor, but high concentrations offend the human palate.(2,14)

Not all grazers retain DMS in their tissues, though. At sea, DMS is released when zooplankton feed on algae. It’s been shown in the marine copepods Labidocera aestiva and Centropages hamatus feeding on the dinoflagellate Gymnodinium nelson that nearly all the DMS in the consumed algae is quickly released during feeding and digestion.(15) This has a disadvantage for the grazing zooplankton. Marine predators, like procellariiform seabirds, harbor seals, penguins, whale sharks, cod, and coral reef fishes like brown chromis, Creole wrasse and boga, can use the smell of DMS to locate zooplankton to feed on. (8,16,17)

It’s not easy to measure how much DMS is released from the Ocean into the air every year. Recent estimates suggest 13-37 Teragrams, or 1.3-3.7 billion kilograms. This accounts for about half the natural transport of Sulfur into the atmosphere, is the conveyor belt by which Sulfur cycles from the ocean back to land. In the atmosphere, DMS is oxidized into several compounds that serve as Cloud Condensation Nuclei (CCN). The presence of CCN in the air determines when and where clouds form, which affects not only the Water cycle, but the reflection of sunlight away from the Earth. This is why climate scientists believe DMS plays an important role in regulating the Earth’s climate. (12,18)

  • 1) BATES, T. S., J. D. Cline, R. H. Gammon, and S. R. Kelly-Hansen. 1987. Regional and seasonal variations in the flux of oceanic dimethylsulfide to the atmosphere. J. Geophys. Res.92: 2930- 2938
  • 2) Hill, RW, Dacey, JW and A Edward. 2000. Dimethylsulfoniopropionate in giant clams (Tridacnidae). The Biological Bulletin, 199(2):108-115
  • 3) Brooke, R.O., Mendelsohn, J.M., King, F.J. 1968. Significance of Dimethyl Sulfide to the Odor of Soft-Shell Clams. Journal of the Fisheries Research Board of Canada, 25:(11) 2453-2460
  • 4) Linder, M., Ackman, R.G. 2002. Volatile Compounds Recovered by Solid-Phase Microextraction from Fresh Adductor Muscle and Total Lipids of Sea Scallop (Placopecten magellanicus) from Georges Bank (Nova Scotia). Journal of Food Science, 67(6): 2032–2037
  • 5) Le Guen, S., Prost, C., Demaimay, M. 2000. Critical Comparison of Three Olfactometric Methods for the Identification of the Most Potent Odorants in Cooked Mussels (Mytilus edulis). J. Agric. Food Chem., 48(4): 1307–1314
  • 6) Piveteau, F., Le Guen, S., Gandemer, G., Baud, J.P., Prost, C., Demaimay, M. 2000. Aroma of Fresh Oysters Crassostrea gigas: Composition and Aroma Notes. J. Agric. Food Chem., 48(10): 4851–4857
  • 7) Tanchotikul, U., Hsieh, T.C.Y. 2006. Analysis of Volatile Flavor Components in Steamed Rangia Clam by Dynamic Headspace Sampling and Simultaneous Distillation and Extraction. Journal of Food Science, 56(2): 327–331
  • 8) Ellingsen, O.F., Doving, K.B. 1986. Chemical fractionation of shrimp extracts inducing bottom food search behavior in cod (Gadus morhua L.). J. Chem. Ecol., 12(1): 155-168
  • 9) Sarnoski, P.J., O’Keefe, S.F., Jahncke, M.L., Mallikarjunan, P., Flick, G. 2010. Analysis of crab meat volatiles as possible spoilage indicators for blue crab (Callinectes sapidus) meat by gas chromatography–mass spectrometry. Food Chemistry, 122(3):930–935
  • 10) Malin, G., Kirst, G.O. 1997. Algal Production of Dimethyl Sulfide and its Atmospheric Role. J. Phycol., 33:889-896
  • 11) Keller, M.D., Bellows, W.K., Guillard, R.L. 1989. Dimethyl Sulfide Production in Marine Phytoplankton. Biogenic Sulfur in the Environment. Chapter 11, pp 167–182. ACS Symposium Series, Vol. 393. ISBN13: 9780841216129eISBN: 9780841212442.
  • 12) Yoch, D.C. 2002. Dimethylsulfoniopropionate: Its Sources, Role in the Marine Food Web, and Biological Degradation to Dimethylsulfide. Appl Environ Microbiol., 68(12):5804–5815.
  • 13) Otte ML, Wilson G, Morris JT, Moran BM. 2004. Dimethylsulphoniopropionate (DMSP) and related compounds in higher plants. J Exp Bot., 55(404):1919-25
  • 14) Van Bergeijk, S.A., Stal, L.J. 2001. Dimethylsulfonopropionate and dimethylsulfide in the marine flatworm Convoluta roscoffensis and its algal symbiont. Marine Biology, 138:209-216
  • 15) Dacey , J.W.H. and Stuart G. Wakeham. 1986. Oceanic Dimethylsulfide: Production during Zooplankton Grazing on Phytoplankton. Science, 233( 4770):1314-1316
  • 16) Nevitt, G. A., Veit, R. R. & Kareiva, P. (1995) Dimethyl Sulphide as a Foraging Cue for Antarctic Procellariiform Seabirds. Nature 376, 680-682.
  • 17) Debose, J.L., Lema, S.C., & Nevitt, G.A. (2008). Dimethylsulfionoproprianate as a foraging cue for reef fishes. Science, 319, 1356.
  • 18) Charlson, R.J., Lovelock, J.E., Andraea, M.O., Warren, S.G. 1987. Oceanic phytoplankton, atmospheric sulphur, cloud albedo and climate. Nature, 326:655-661
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Forms lek during breeding (Ref. 55367). A monandric species (Ref. 55367). Length at sex change = 15.78 cm TL (Ref. 55367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clepticus parrae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTATTCGGCGCCTGAGCAGGAATAGTCGGTACCGCACTAAGCTTACTTATCCGGGCCGAGCTAAGCCAACCTGGGGCTCTCCTCGGAGACGACCAGATTTACAATGTCATCGTCACGGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGCTTTGGAAACTGACTTATTCCCCTAATAATTGGAGCCCCCGACATAGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCACCTTCATTCCTTCTTCTACTTGCCTCTTCTGGTGTAGAAGCCGGGGCAGGGACTGGATGAACCGTCTACCCCCCTTTGGCTGGTAATCTGGCCCACGCAGGAGCCTCGGTTGACCTAACCATCTTCTCCCTCCACCTCGCGGGTATCTCTTCAATTTTAGGAGCAATTAATTTTATCACAACTATCATTAACATGAAGCCGCCTGCTATCTCCCAATACCAAACCCCTCTCTTTGTCTGAGCAGTCTTAATTACAGCAGTACTGCTCCTGCTTTCACTTCCCGTCCTTGCTGCCGGCATTACAATACTTTTAACAGACCGAAACCTGAACACTACCTTCTTTGACCCTGCAGGAGGGGGAGACCCTATTCTGTACCAGCACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clepticus parrae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H., Rocha, L. & Craig, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the northwestern Atlantic and is abundant. It is primarily found schooling near reefs. There are no major threats known to this species. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. This species is considered common throughout its range. For example, it is common in San Blas (Warner and Robertson 1978) and in the Gulf of Mexico (Precht et al. 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species specific conservation measures. However, this species distribution overlaps a number of Marine Protected Areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.   http://www.fishbase.org/references/FBRefSummary.php?id=9210 External link.
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Clepticus parrae

The Creole wrasse (Clepticus parrae) is a species of fish in the wrasse family Labridae.

Contents

Description

The creole wrasse is a small wrasse, with males reaching around 30 centimetres (one foot) in length, while females are smaller. It has a typical wrasse shape. Like many wrasse, it changes colour markedly during its lifetime, with juveniles being almost completely violet-purple. As it matures, it develops a yellow patch on the rear part of its body.[1]

Ecology

The creole wrasse is found throughout the western Atlantic Ocean and the Caribbean Sea, where it is commonly seen aggregating on coral reef slopes, down to around 100 metres (330 feet) in depth. These groups feed together on plankton, including small jellyfish, pelagic tunicates and invertebrate larvae.[2] The creole wrasse is active by day, and at night it retreats alone to a rocky crevice in the reef to sleep.

Reproduction

The creole wrasse is a protogynous hermaphrodite: the largest fish in a group is a dominant breeding male, while smaller fish remain female. If the dominant male dies, the largest female changes sex. The mature males congregate at leks to breed, at which they display and are approached by females before mating with them.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!