Overview

Brief Summary

Ecology

Neogobius melanostomus originally inhabited the Ponto-Caspian area (Black Sea, Azov Sea and Caspian Sea).
  • van Beek, G.C.W. (2006). [The round goby Neogobius melanostomus first recorded in the Netherlands]. Aquatic Invasions 1(1): 42-43
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

In the Netherlands, round gobies seem to favor brackish waters
  • van Beek, G.C.W. (2006). [The round goby Neogobius melanostomus first recorded in the Netherlands]. Aquatic Invasions 1(1): 42-43
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

New York State Invasive Species Information

The round goby (Neogobius melanostomus), a native of freshwater and marine waters of Eurasia (particularly the Black and Caspian Seas and the Sea of Azov), was first observed in the Great Lakes Basin in 1990 when recreational anglers caught a specimen in the St. Clair River. It is believed that the species was introduced via international shipping ballast water discharge. Since that time, the fish has spread to all of the Great Lakes (Lake Erie, 1993; Lake St. Clair, 1994; Lake Michigan, 1994; Lake Superior, 1995; Lake Ontario, 1996; Lake Huron, 1998), where it is undergoing a dramatic population explosion (densities of several dozen per square meter of lakebed have been reported). Spread upstream to Lake Superior is believed to have been a result of interlake ballast water transport; downstream spread is most likely attributable to both ballast discharge and natural migration. Round gobies may prey on small fish such as darters, as well as lake trout, sculpin, and darter eggs and fry.

Adult gobies take over prime nearshore spawning sites and aggressively prevent use by native species. Long-term impacts are expected to include declines in native species populations. N. melanostomus has a well-developed lateral line which may give it a competitive advantage over native species feeding in turbid waters. Round gobies are also prolific breeders, spawning every 20 days during the spawning season.

Round gobies are problematic to anglers in that gobies are proficient bait thieves.

Neogobius melanostomus has the beneficial impact of consuming large numbers of zebra mussels; however, given the contamination found in some populations of zebra mussels, this may result in bioaccumulation of toxics in gobies and biomagnification up the food chain to shorebirds and other species which consume the fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The New York Invasive Species Clearinghouse, Cornell University Cooperative Extension

Supplier: Tracy Barbaro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Neogobius melanostomus (Pallas, 1814)

Aegean Sea : 20300-585 (1 spc.), February 2001 , Bozcaada Island , trammel net , 30 m, L. Eryilmaz ; 20300-601 (2 spc.), February 2001 , Bozcaada Island , trammel net , 30 m, L. Eryilmaz . Inland water: 20300-625 (2 spc.), 28.10.1974 , Bueyuekcekmece Lagoon , Istanbul , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 51-51, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Prefer shallow, brackish waters but also occur in fresh waters (Ref. 36771); in lagoons and lakes, large rivers, harbors, on sand or rock bottom; mostly found on well vegetated or rock bottom (Ref. 59043). Can tolerate a temperature range of 0 to 30°C, but mainly thrive in warm temperate waters; able to tolerate low oxygen content waters for several days (Ref. 36771). Oviparous, with demersal eggs (Ref. 36771). Longevity up to 4 years. Males reproduce for the first time at 3-4 years, females at 2-3 years. Spawning season in April to September; females may repeat spawning during a season, every 18-20 days; body of males entirely black during this season. Adhesive eggs deposited on stones, shells and aquatic plants; males guard eggs until hatching and usually die after spawning season. Egg clutches are supposed to be occasionally transported attached to the hull of ships, facilitating introduction to other areas. Feeds on a wide variety of invertebrates and small fish, mostly on molluscs (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to the vicinity of the Black and Caspian seas. First discovered in the Great Lakes basin in 1990 (Jude et al. 1992); probably arrived in ballast water discharged by transoceanic vessel(s); now established (Lake Erie basin to Lake Superior basin) and rapidly spreading; has access to the Mississippi River system via an established population in the Grand Calumet River near Chicago (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Azov, Black and Caspian Sea basins. Invasive in Baltic basin, which it reached via navigation canals. Reached westwards to German Baltic coast in 2002. Recently recorded in lower parts of rivers in Gulf of Gdansk (Poland). Also moving upwards in rivers of its original range; in Volga upstream to Moscow and north to Lake Rybinskoye; in Dniepr up to Belarus, in Danube reached Austria in 2000. Accidentally arrived in North America in 1991 and lowermost Rhine (Netherlands) in 2004 with ballasts water in ships.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Round gobies are native to the Black, Caspian, Marmara, and Azov Seas and their tributaries in Eurasia.

Round gobies have been introduced in several areas outside of their native range. They are an invasive species in the Great Lakes region of North America, with a rapidly expanding range there. Round gobies are beginning to enter the river drainages of the Great Lakes, including the Chicago River, eventually resulting in the invasion of the Mississippi River drainage.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe: Sea of Azov, Black Sea and Caspian basins. Adverse ecological impact after introduction have been reported by several countries. In 2004, this was accidentally introduced in North America with ballast water in ships (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Round gobies are native to the Black, Caspian, Marmara, and Azov Seas and their tributaries in Eurasia.

Round gobies have been introduced in several areas outside of their native range. They are an invasive species in the Great Lakes region of North America, with a rapidly expanding range there. Round gobies are beginning to enter the river drainages of the Great Lakes, including the Chicago River, eventually resulting in the invasion of the Mississippi River drainage.

They have also been introduced into the Moscow River and the Baltic Sea. They are especially problematic in the Gulf of Gdansk, where populations densities have exploded, but they have been subsequently found in many parts of the Baltic Sea and into the Danube River. It is not clear how round gobies were introduced to the Baltic Sea.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Basins of the Black, Azov and Caspian seas; introduced elsewhere (including U.S.A. and Canada).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Round gobies are small fish with large, frog-like heads, raised eyes, soft bodies, and spineless dorsal fins. Males are generally larger than females. They have a distinctive black spot on their front dorsal fin. Mature round gobies are covered by black and brown splotches that lighten when threatened. Round gobies are distinguished from Cottidae by their fused pelvic fin, which is also called a suctorial disc and is used to help attach to a surface in flowing water.

Range length: 11 to 30 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 7 - 8; Dorsal soft rays (total): 12 - 17; Analspines: 1; Analsoft rays: 9 - 14; Vertebrae: 31 - 34
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Typically under 18 centimeters in length, but with some individuals reaching 30 centimeters, round gobies have large frog-like heads with raised eyes, soft bodies, and spineless dorsal fins. Males are generally larger than females, although size varies regionally. They also have a distinctive black spot on their front dorsal fin. Mature round gobies are covered by black and brown splotches that lighten in color when threatened. Round gobies are distinguished from sculpins of similar appearance by their fused pelvic fin, which is characteristic of the family Gobiidae. This fused fin is also called a suctorial disc and is used to help attach to a surface in flowing water.  A characteristic of the family Gobiidae is the absence of a swim bladder, which is used for buoyancy control. Round gobies can be confused with native black gobies in the Baltic Sea.

Range length: 11 to 30 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.6 cm TL (male/unsexed; (Ref. 36771)); max. reported age: 4 years (Ref. 36771)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from sculpins in having fused rather than separate pelvic fins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is distinguished from its congeners entering freshwater in Europe by the following characters: first branched ray of second dorsal about as long as penultimate ray; no scales on midline of nape, in front of preoperculum; pelvic-disc fraenum with small rounded lobes and the length is less than 1/6 of width at base; scales in midlateral series 45-54 + 2-3; a large black spot on the posterior part of first dorsal (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: In the Black and Caspian seas, habitat is mainly nearshore areas, with movements to deeper water (up to 60 m) for winter; occurs also in rivers and slightly brackish water; prefers rocky or gravelly habitat; when startled, hides in crevices or actively burrows into gravel; able to tolerate degraded water quality; eggs are deposited in nests on the tops or undersides of rocks, logs, or cans; aggressively defends spawning sites (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
Inshore habitats, estuaries, brackish- and fresh-water lagoons and lakes, large rivers, harbours, on sand or rock bottom. To 50-60 m deep in Black Sea during winter. Mostly found on well vegetated or rock bottom.

Biology:
Lives up to four years. Males reproduce for the first time at 3-4, females at 2-3. Spawns in April-September. Males have entirely black body during spawning season. Individual females may repeat spawning during a season every 18-20 days. Adhesive eggs are deposited under or between stones, shells and aquatic plants. Males guard eggs until eggs hatch, in 2-3 weeks. Males usually die after spawning season. Feeds on a wide variety of invertebrates and small fish. Egg clutches are supposed to be occasionally transported attached to the hull of ships, facilitating the invasion of new areas.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bottom dwellers in the nearshore region of lakes and in rivers, round gobies prefer rocky habitats that provide lots of hiding opportunities. These habitats also include areas with sunken objects, piers, and mussel beds. Round gobies can be found in fresh or brackish water and at depths of 0 to 30 meters. They can survive in water temperatures of 0 to 30 degrees Celsius, but tend to thrive in warmer waters. Round gobies are able to survive in areas with poor water quality. They can also withstand low oxygen concentrations. Both of these qualities made them well-suited to surviving in ballast water, which is how they were introduced in the Great Lakes.

Range depth: 0 to 30 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; amphidromous (Ref. 46888); freshwater; brackish; marine; depth range 0 - 30 m (Ref. 36771)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bottom dwellers in the nearshore region of lakes and in rivers, round gobies prefer rocky habitats that provide lots of hiding opportunities. These habitats also include areas with sunken objects, piers, and mussel beds. Round gobies can be found in fresh or brackish water and at depths of 0 to 30 meters. They can survive in water temperatures of 0 to 30 degrees Celsius, but tend to thrive in warmer waters. Round gobies are able to survive in areas with poor water quality. They can also withstand low oxygen concentrations. Both of these qualities made them well-suited to surviving in ballast water, which is how they were introduced in the Great Lakes.

Range depth: 0 to 30 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.135 - 20.1

Graphical representation

Depth range (m): 0.135 - 20.1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet includes bivalves, large invertebrates, and the eggs and fry of native fishes such as sculpins, darters, and logperches; in the U.S., documented foods include insect large and zebra mussels (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Round gobies are voracious feeders. Up to 60% of their diet is made up of Bivalvia in some places. They also eat aquatic insect larvae, the young and eggs of other fish, and aquatic snails. In the Great Lakes they prey on Dreissena polymorpha, another Great Lakes exotic from the same native region. They can eat up to 78 zebra mussels each day. A complete lateral line system allows them to feed in complete darkness. In the Great Lakes they also eat the young and eggs of Cottus bairdii, Percina caprodes, Etheostoma, and Salvelinus namaycush, among other species, making them a threat to those native populations.

Animal Foods: fish; eggs; insects; mollusks; aquatic crustaceans

  • Ghedotti, M., J. Smihula, J. Smith. 1995. Zebra mussel predation by round gobies in the laboratory. Journal for Great Lakes Research, 21: 665-669.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Prefer shallow, brackish waters but also occur in fresh waters (Ref. 36771). Lives over stones; in freshened areas and river mouths (Ref. 2058). Can tolerate a temperature range of 0 to 30°C, but mainly thrive in warm temperate waters (Ref. 36771). Able to tolerate low oxygen content waters for several days (Ref. 36771).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Round gobies are voracious feeders, with a penchant for stealing bait off the hooks of anglers. They eat mussels and other mollusks, with up to 60% of their diet made up of mussels in some places. They also eat aquatic insect larvae and the young and eggs of other fish. In the Baltic Sea they impact blue mussels populations. In the Great Lakes they prey on zebra mussels, another Great Lakes exotic from the same native region. A complete lateral line system allows them to feed in complete darkness. In the Great Lakes they also eat the young and eggs of mottled sculpin, logperch, darter species, and lake trout, among other species, making them a threat to those native populations.

Animal Foods: fish; eggs; insects; mollusks; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Molluscivore )

  • Ghedotti, M., J. Smihula, J. Smith. 1995. Zebra mussel predation by round gobies in the laboratory. Journal for Great Lakes Research, 21: 665-669.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Round gobies compete with native species where they are introduced. In the Great Lakes, they compete directly with similar fish, such as Cottus bairdii, which they completely displace from spawning and foraging areas. They also compete with, and eat the young and eggs of, Percina caprodes and Etheostoma.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Their hop-like swimming style and blotchy coloration that helps them blend in with their surroundings are defenses against predators. Round gobies are eaten by large, predatory fish and diving and wading birds.

Known Predators:

  • great cormorants (Phalacrocorax_carbo)
  • walleye (Stizostedion_vitreum)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Round gobies compete with native species where they are introduced. In the Great Lakes, they compete directly with similar fish, such as mottled sculpin, which they completely displace from spawning and foraging areas. They also compete with, and eat the young and eggs of, logperch and darter species. In the Baltic Sea they compete with three-spined sticklebacks, flounder, and viviparous blennies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Their hop-like swimming style and blotchy coloration that helps them blend in with their surroundings are defenses against predators. Round gobies are eaten by large, predatory fish, such as walleye, and diving and wading birds. In the Baltic Sea they are important prey for great cormorants.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Capable of rapid population growth; density in rocky areas of Calumet Harbor exceeds 20 per square meter (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Round gobies, like most other fish, use visual and chemical cues in communication. They have a complete lateral line system that helps them to hunt in dark water or at night.

Communication Channels: visual

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Round gobies, like most other fish, use visual and chemical cues in communication. They have a complete lateral line system that helps them to hunt in dark water or at night.

Communication Channels: visual

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Can feed in complete darkness (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

There is almost no larval stage in the development of round gobies. Eggs take up to 18 days to hatch.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males protect embryos and juveniles (Ref. 36771). Males die after the spawning season (Ref. 36771).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

There is almost no larval stage in the development of round gobies. Eggs take up to 18 days to hatch.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Maximum reported lifespan in round gobies is 4 years. After males defend their nests during the breeding season, they die. Females can live to about 3 years old.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: captivity:
4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Maximum reported lifespan in round gobies is 4 years. After males defend their nests during the breeding season, they die. Females can live to about 3 years old.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: captivity:
4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns over a long period in the warmer months; male guards eggs; females mature at 1-2 years, males at 3-4 years (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males guard nests and attract females to spawn there. Multiple females may leave their eggs in a single male's nest.

Mating System: polygynous

Female round gobies spawn repeatedly, approximately every 20 days, from April until September while males guard the eggs and young. This repeated spawning gives them an ecological advantage over species which spawn less frequently. Females are mature by 2 to 3 years of age and males at 3 to 4 years. Females deposit 89 to 3841 eggs at a time. Fecundity is directly related to female body size. Eggs are laid on a hard substrate, such as gravel, rocks, or even submerged trash, and are then guarded by the male until hatching.

Breeding interval: Female round gobies can spawn every 20 days during the warm season, from April to September.

Breeding season: Spawning occurs from April to September.

Range number of offspring: 89 to 3841.

Range time to hatching: 18 (high) days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Males aggressively guard eggs at nest sites until they hatch.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

  • Marsden, J., D. Jude. 1995. Round gobies invade North America. Great Lakes SeaGrant Factsheet, FS 065.
  • Sapota, M. 2006. "NOBANIS – Invasive Alien Species Fact Sheet – Neogobius melanostomus" (On-line). Online Database of the North European and Baltic Network on Invasive Alien Species. Accessed December 11, 2008 at http://www.nobanis.org/files/factsheets/Neogobius_melanostomus.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males guard nests and attract females to spawn there. Multiple females may leave their eggs in a single male's nest. In some introduced populations, there is an extremely skewed sex ratio, with 2 to 3 males for every female. In native populations the sex ratio is roughly equal.

Mating System: polygynous

Female round gobies spawn repeatedly, approximately every 20 days, from April until September while males guard the eggs and young. This repeated spawning gives them an ecological advantage over species which spawn less frequently. Females are mature by 2 to 3 years of age and males at 3 to 4 years. Females deposit 89 to 3841 eggs at a time. Fecundity is directly related to female body size. Eggs are laid on a hard substrate, such as gravel, rocks, or even submerged trash, and are then guarded by the male until hatching.

Breeding interval: Female round gobies can spawn every 20 days during the warm season, from April to September.

Breeding season: Spawning occurs from April to September.

Range number of offspring: 89 to 3841.

Range time to hatching: 18 (high) days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Males aggressively guard eggs at nest sites until they hatch.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

  • Marsden, J., D. Jude. 1995. Round gobies invade North America. Great Lakes SeaGrant Factsheet, FS 065.
  • Sapota, M. 2006. "NOBANIS – Invasive Alien Species Fact Sheet – Neogobius melanostomus" (On-line). Online Database of the North European and Baltic Network on Invasive Alien Species. Accessed December 11, 2008 at http://www.nobanis.org/files/factsheets/Neogobius_melanostomus.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Neogobius melanostomus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 45
Specimens with Barcodes: 63
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Neogobius melanostomus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTTGTATTTGGCGCCTGAGCCGGAATAGTCGGGACCGCCCTAAGCCTGCTCATTCGAGCAGAATTAAGCCAGCCCGGCGCTCTCCTGGGGGACGACCAGATCTATAATGTAATTGTTACCGCCCACGCTTTCGTAATAATTTTCTTTATAGTTATACCTATTATGATTGGGGGCTTTGGAAACTGGTTAATCCCCCTAATGATTGGGGCCCCCGATATGGCATTTCCTCGAATAAACAACATAAGCTTCTGATTGCTCCCTCCTTCTTTCTTACTACTTCTGGCCTCCTCTGGTGTTGAAGCAGGGGCAGGAACCGGGTGGACAGTTTACCCTCCCCTGGCAGGCAACTTGGCACATGCAGGAGCATCCGTCGACTTGACAATCTTCTCCCTTCACCTGGCCGGCATTTCCTCAATTCTAGGGGCTATTAATTTTATTACCACAATATTAAATATAAAACCCCCCGCCGTCTCACAATACCAGACCCCTCTCTTCGTCTGATCAGTTCTGATTACGGCGGTCCTACTCCTCCTCTCCCTCCCAGTTCTTGCCGCCGGAATTACCATGCTTTTAACTGACCGAAATTTAAATACCACTTTCTTTGACCCTGCCGGGGGAGGGGATCCTATTCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Native to the vicinity of the Black and Caspian seas; recently introduced, established, and spreading in the Great Lakes basin.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
A widespread species with no known major widespread threats.

History
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As an invasive species in the United States, efforts to reduce round goby populations are underway. They have no special status in their native range, though their cousins, Proterorhinus marmoratus, which are also invasive in the Great Lakes, are endangered in the Black Sea region.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As an invasive species in the United States, efforts to reduce round goby populations are underway. They have no special status in their native range, though their cousins, tubenose gobies, which are also invasive in the Great Lakes, are endangered in the Black Sea region.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Very abundant and expanding range

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: In North America, the primary management need is the prevention of further range expansion.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Needs: As necessary and appropriate, develop and enforce regulations against the transport of this fish; this includes ballast dumping regulations (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: In the Great Lakes area, walleye anglers sometimes are bothered by round gobies attacking baited hooks (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Because round gobies often eats bivalves that filter the water, they are vectors for bioaccumulation of many contaminants. The contaminants that build up in round gobies are passed on to larger game fish and then possibly on to humans. Round gobies are a threat to native fish species, which they drive out of preferred habitat and compete directly for prey. Round gobies are a nuisance to anglers who lose their bait to them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

In its native region of the Black and Caspian Seas, round gobies are prey fish for economically important food fishes, and are also fished for food. In the Great Lakes, they feed on zebra mussels, another exotic species that causes a host of problems. It does not reduce the concentration enough to control these mussels, though.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; aquarium: commercial; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Because round gobies often eats bivalves that filter the water, they are vectors for bioaccumulation of many contaminants. The contaminants that build up in round gobies are passed on to larger game fish and then possibly on to humans. Round gobies are a threat to native fish species, which they drive out of preferred habitat and compete directly for prey. Round gobies are a nuisance to anglers who lose their bait to them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

In its native region of the Black and Caspian Seas, round gobies are prey fish for economically important food fishes, and are also fished for food. In the Great Lakes, they feed on zebra mussels, another exotic species that causes a host of problems. It does not reduce the concentration enough to control these mussels, though.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Introduced populations in North America are of concern because they may outcompete and/or prey upon native benthic fishes such as sculpins and darters, and possibly they may prey on eggs and fry of lake trout (Marsden and Jude 1995).

The zebra mussel is a common food item, and these fishes may, in concert with ducks, crayfish, disease, and other fishes, act to limit zebra mussel abundance (Marsden and Jude 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Round goby

The round goby (Neogobius melanostomus) is an euryhaline bottom-dwelling goby of the family Gobiidae, native to central Eurasia including the Black Sea and the Caspian Sea. Round gobies have established large non-native populations in the Baltic Sea, several major Eurasian rivers, and the North American Great Lakes.[2]

Characteristics[edit]

Round gobies are small, soft-bodied fish, characterized by a distinctive black spot on the first dorsal fin. Their eyes are large and protrude slightly from the top of the head and, like most gobies, round gobies have pelvic fins that are fused to form a single disc on the belly of the fish shaped like a suction cup. Round gobies range in length from 4 to 10 inches (maximum of 9.7 inches (24.6 cm), and in weight from 0.176 ounces to 2.816 ounces, increasing as they age. Male round gobies are larger than females. Juvenile round gobies (less than one year old) are grey. Upon maturation, round gobies become mottled with gray, black, brown, and olive green markings. Adult male round gobies turn inky black during the spawning season and develop swollen cheeks. Male and female round gobies are easily differentiated through the shape of their urogenital papilla, which is white to grey, long and pointed in males, and brown, short and blunt-tipped in females.

Range/Habitat[edit]

Widespread in the Sea of Marmara and rivers of its basin. In the Black Sea and Sea of Azov along all coasts and fresh waters of their basins. In the coastal lakes and lagoons. In the rivers of Crimea and Caucasus: Mezib, Pshada, Vulan, Kodori, Çoruh. In the Caspian Sea presented by subspecies Neogobius melanostomus affinis. Since 1990 the round goby registered as introduced in the North American Great Lakes as an invasive species.[3] and different parts of Europe including the Baltic Sea. Round gobies are also rapidly expanding into tributaries of the Great Lakes in North America, and were recently discovered in at least one of the Finger Lakes in New York state (Cayuga Lake).

Round gobies are euryhaline (salt-tolerant) and are found in both freshwater and marine ecosystems. In habits the water with mineralization of 18–24%, presented in fresh waters. Rather common on shelfs with sandy and rocky bottoms with low silting, on the depth from 1–2 to 10–17 m.

Feeding[edit]

Round gobies actively feed both nocturnally and diurnally, and are believed to detect prey only while stationary. The primary diet of round gobies includes mollusks, crustaceans, worms, fish eggs, zebra mussels, small fish, and insect larvae.

Adult round gobies feed mainly on mollusks and other small invertebrates (insects and amphipods) living on the bottom of lakes and streams.[2] At spring, the main items in its diet in the Sasyk Lagoon are Hydrobia, Cerastoderma, Abra.[4] In the same season near the Romanian coasts of the Black Sea the round goby feeds on polychaetes, crustaceans (Idothea balthica, Pachygrapsus marmoratus, Xantho poressa, etc.) and juvenile gobies.[5] Near Sevastopol the round goby feeds on molluscs (Mytilaster lineatus, Abra spp.), but near Karadag except molluscs (Cerastoderma, Brachiodontes) were fishes.[6]

In the Gulf of Odessa in the diet of the round goby are 23 items.[7] Mytilus galloprovincialis, Setia pulcherrima, Mytilaster lineatus, Lentidium mediterraneum, Idothea balthica, and Alitta (Nereis) succinea dominate in spring. In summer are mainly Sphaeroma pulchellum and L. mediterraneum. Mussels M. galloprovincialis and M. lineatus have big importance in the diet in all seasons. The polychaetes are most elected component of benthos.

Reproduction[edit]

Round goby eggs on rocks, Dniester Estuary, Ukraine

Round gobies exhibit male parental care. Females can spawn up to six times during the spawning season, which spans April to September in most areas. Males will migrate from deeper water, where overwintering occurs, into shallower breeding grounds during the beginning of the mating season. Males are territorial and will defend eggs from predators, as well as continuously fan them to provide the developing embryos with oxygenated water. This results in successful hatch rates of up to 95%. Its eggs are 4 mm by 2.2 mm in size. Female round gobies reach sexual maturity in 1 to 2 years while males do so in 3 to 4 years. Gobies in the Laurentian Great Lakes typically mature up to 1 year earlier than in their native habitat in Europe. The male releases a steroid sex pheromone that attracts females to their territory. Males also use visual displays, including posturing and changing its color from beige to black during mating season. They also produce sounds during courtship. The females deposit their eggs in male-guarded crevices between rocks. Egg clutches can contain up to 5,000 eggs.

Invasive species[edit]

Round goby from the Great Lakes, USA

The species was accidentally introduced into the North American Great Lakes by way of ballast water transfer in cargo ships. First discovered in North America in the St. Clair River in 1990, the round goby is considered an invasive species with significant ecological and economic impact;[8] the consequences are quite complex as the fish both competes with native species and provides an abundant source of food for them while consuming other invasive species.[9] In other words, the round goby behaves much like most biological invasive controls. An aggressive fish, the round goby outcompetes native species such as the sculpin and logperch for food (such as snails and mussels), shelter and nesting sites, substantially reducing their numbers. Round gobies are also voracious predators of eggs of native fish, many important to the angling industry. The goby's robust ability to survive in degraded environmental conditions has helped to increase its competitive advantage compared to native species. Many native predatory fish such as smallmouth bass, largemouth bass, walleye, salmon and trout have begun to prey on round gobies. These game fish feed so heavily on the abundant gobies that a bait company, called Culprit, has created a soft plastic bait called the "Great Lakes Goby" to exploit this behavior. The incorporation of the round goby into native foodwebs, coupled with the goby's ability to consume large numbers of invasive mussels (zebra and quagga), may result in greater bioaccumulation of toxins such as PCBs higher in the food chain, since these mussels filter-feed and are known to accumulate persistent contaminants. However, this is partly beneficial because even though they do not reduce the population of zebra mussels, they do control their population. Hence, it prevents a large scale spread of the zebra mussel, which is also an invasive species in the Great Lakes.

An unintended benefit of the round goby's introduction is that the Lake Erie Watersnake, once listed as a threatened species, has found it to be a tasty addition to its diet. A recent study found the introduced fish now accounts for up to 90% of the snake's diet. The new food supply means that the water snake is now staging a comeback.[10] Round gobies also serve as food for a variety of predatory fishes in the Great Lakes, including bass, lake trout, lake whitefish, burbot, and walleye.

The round goby is also considered invasive in parts of Europe. The processes of invasion of the round goby in Europe were started by its introduction to the Gulf of Gdańsk (Southern Baltic Sea) in 1990.[11] Recently the cases of the round goby invasion are mentioned in the Aegean Sea,[12] in the different parts of the Baltic Sea,[13] North-Sea basin,[14] and basins of the rivers Danube and Rhine.[15][16] In the German part of the Baltic Sea this fish was first noted near the Rügen Island.[17] Now it is distributed along all south-western Baltic Sea coast includes the Stettiner Haff (Szczecin Lagoon), the Unterwarnow (the Estuary of the Warnow River), the mouth of the Trave River, and in the Nord-Ostsee (Kiel) Kanal.

At this time, the westernmost site of the round goby occurrence in Europe is the Lower River Scheldt, the tidal zone in the river mouth, and Albert Canal, Belgium.[18] In 2011, the expansion of the round goby through the fresh waters of France is started: this species occurred in the Rhine River (on the border between France and Germany), also in the French part of the Moselle River.[19]

Parasites[edit]

In total, 52 parasite species are registered in the round goby in the native area.[20] Most abundant parasites of the Black-Sea round goby are metacercariae of trematodes of Heterophyidae family, such as Cryptocotyle concavum, C. lingua, and Pygidiopsis genata.[21] The trematodes C. lingua and P. genata can infest human.[22][23] In the 1950s, along the coast of the Gulf of Taganrog (Sea of Azov) the round roby was registered as a host of epizootic of nematodes, Tetrameres fissispina and Streptocara crassicauda, which were fatal to ducklings.[24]

In the Gulf of Gdańsk, Baltic Sea, the parasite fauna of the invasive round goby consists of 12 species.[25] The core of the parasite fauna comprises two species of trematode metacercariae: C. concavum and Diplostomum spathaceum. Also, in the Baltic Sea the round goby is paratenic host of the invasive nematode Anguillicoloides crassus.[26] In the Vistula Lagoon, the most abundant parasites of the round goby are nematodes Hysterothylacium aduncum and A. crassus.[27]

25 species of parasites are noted in the round goby in the Great Lakes.[28][29][30][31] The trematode D. spathaceum is most abundant core species overall. Also the cestode Proteocephalus sp. and the trematode Neochasmus umbellus are rather abundant. The round goby may circumvent more of the metacercariae of N. umbellus from completing their life cycle.[32] The parasite “load” on the invasive gobies in the Great Lakes appears relatively low in comparison with their native habitats, lending support to the "enemy release hypothesis".

See also[edit]

References[edit]

  1. ^ Freyhof, J. & Kottelat, M. 2008. Neogobius melanostomus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 September 2013.
  2. ^ a b Kornis, M. S.; Mercado-Silva, N; Vander Zanden, M. J. (2012). "Twenty years of invasion: A review of round goby Neogobius melanostomus biology, spread and ecological implications". Journal of Fish Biology 80 (2): 235–85. doi:10.1111/j.1095-8649.2011.03157.x. PMID 22268429.  edit
  3. ^ Jude D.J., Reider R.H., Smith G.R. (1992). "Establishment of Gobiidae in the Great Lakes basin". Can. J. Fish. Aquat. Sci. 49: 416–421. doi:10.1139/f92-047. 
  4. ^ Smirnov A.I. (1986) Perch-likes (gobiids), scorpionfishes, flatfishes, clingfishes, anglerfishes [in:] Fauna of Ukraine, Vol. 8, No 5, Kiev: Naukova Dumka, 320 pp. (in Russian)
  5. ^ Porumb I.I. (1961) Contribuţii la cunoşterea biologiei guvisilor (Gobius batrachocephalus, Gobius cephalarges şi Gobius melanostomus) din dreptul litoralului Romînesc al Mării Neagre (date preliminare), Hidrobiologia, 3, 271—282.
  6. ^ Khirina V.A. (1950) Materialy po pitaniju nekotoryh bentosnyh ryb v pribrezhnoj zone Chernogo moria u Karadaga. Trudy Karadagskoy biologicheskoy stantsii, No 10: 53–65.
  7. ^ Kvach Y., Zamorov V. (2001) Feeding preferences of the round goby Neogobius melanostomus and mushroom goby Neogobius cephalarges in the Odessa Bay. Oceanological Studies, 30(3–4): 91–101.
  8. ^ Corkum, L. D.; Sapota, M. R.; Skora, K. E. (2004). "The Round Goby, Neogobius melanostomus, a Fish Invader on both sides of the Atlantic Ocean". Biological Invasions 6 (2): 173. doi:10.1023/B:BINV.0000022136.43502.db.  edit
  9. ^ Lydersen, Karl (May 26, 2011). "The Round Goby, an Uninvited Resident of the Great Lakes, Is Doing Some Good". The New York Times. Retrieved May 27, 2011. "their ecological impact has not been devastating, but complicated — even beneficial in some cases." 
  10. ^ Williams, Rebecca (producer). "Ten Threats: Natives Bite Back". The Environment Report, October 10, 2005. Accessed 11 February 2010.
  11. ^ Skóra K.E., Stolarski J. (1993) New fish species in the Gulf of Gdańsk Neogobius sp. [cf. Neogobius melanostomus (Pallas 1811)]. Bull. Sea Fisheries Inst., 1(128): 83.
  12. ^ Eryilmaz L. (2002) A new fish record for the Aegean Sea: round goby Neogobius melanostomus (Pallas, 1814) (Gobiidae). Israel J. Zool., 48: 251–252.
  13. ^ Sapota, M. R.; Skóra, K. E. (2005). "Spread of alien (non-indigenous) fish species Neogobius melanostomus in the Gulf of Gdansk (south Baltic)". Biological Invasions 7 (2): 157. doi:10.1007/s10530-004-9035-0.  edit
  14. ^ van Beek G.C.W. (2006) The round goby Neogobius melanostomus first recorded in the Netherlands. Aquatic Invasions, 1: 42–43.
  15. ^ Jurajda, P.; Cerny, J.; Polacik, M.; Valova, Z.; Janac, M.; Blazek, R.; Ondrackova, M. (2005). "The recent distribution and abundance of non-native Neogobius fishes in the Slovak section of the River Danube". Journal of Applied Ichthyology 21 (4): 319. doi:10.1111/j.1439-0426.2005.00688.x.  edit
  16. ^ van Kessel N., Dorenbosch M., Spikmans F. (2009) First record of Pontian monkey goby, Neogobius fluviatilis (Pallas, 1814), in the Dutch Rhine. Aquatic Invasions, 4(2): 421–424.
  17. ^ Winkler H.M. (2006) Die Fischfauna der südlichen Ostsee. Meeresangler-Magazin, 16: 17–18.
  18. ^ Verreycken H., Breine J.J., Snoeks J., Belpaire C. (2011) First record of the round goby, Neogobius melanostomus (Actinopterygii: Perciformes: Gobiidae) in Belgium. Acta Ichthyologica et Piscatoria, 41(2): 137–140.
  19. ^ Manné S., Poulet N, Dembski S. (2013) Colonisation of the Rhine basin by non-native gobiids: an update of the situation in France. Knowledge and Management of Aquatic Ecosystems, 411: 02.
  20. ^ Kvach Y. (2002) Round goby’s parasites in native habitats and in a place of invasion. Oceanological Studies, 31(1–2): 51–57.
  21. ^ Kvach Y. (2005) A comparative analysis of helminth faunas and infection of ten species of gobiid fishes (Actinopterigii: Gobiidae) from the North-Western Black Sea. Acta Ichthyologica et Piscatoria, 35(2): 103–110.
  22. ^ Youssef M.M., Mansour N.S., Awadalla H.N., Hammouda N.A., Khalifa R., Boulos L.M. (1987) Heterophyid parasite of man from Idku, Maryat and Manzala Lakes areas in Egypt. J. Egypt. Soc. Parasitol., 17: 474–479.
  23. ^ Zimmerman, M. R.; Smith, G. S. (1975). "A probable case of accidental inhumation of 1,600 years ago". Bulletin of the New York Academy of Medicine 51 (7): 828–37. PMC 1749564. PMID 19312928.  edit
  24. ^ Kovalenko I.I. (1960) Izucenie cikla razvitiâ nekotoryh gel’mintov domasnih utok v hozâjstvah na Azovskom poberez’e. Doklady AN SSSR, 133(5): 1259–1261. (In Russian)
  25. ^ Kvach, Y.; Skóra, K. E. (2006). "Metazoa parasites of the invasive round goby Apollonia melanostoma (Neogobius melanostomus) (Pallas) (Gobiidae: Osteichthyes) in the Gulf of Gdańsk, Baltic Sea, Poland: A comparison with the Black Sea". Parasitology Research 100 (4): 767–74. doi:10.1007/s00436-006-0311-z. PMID 17048001.  edit
  26. ^ Kvach Y. (2004) The Far-Eastern nematode Anguillicola crassus – new parasite of the invasive round goby Neogobius melanostomus in the Baltic Sea. Vestnik Zoologii, 38(2): 38.
  27. ^ Rolbiecki L. (2006) Parasites of the round goby, Neogobius melanostomus (Pallas, 1811), an invasive species in the Polish fauna of the Vistula Lagoon ecosystem. Oceanologia, 48: 545–541.
  28. ^ Camp J.W., Blaney L.M., Barnes D.K. (1999). "Helminths of the round goby, Neogobius melanostomus (Perciformes: Gobiidae), from Southern Lake Michigan, Indiana". J. Helminthol. Soc. Wash. 66: 70–72. 
  29. ^ Muzzall P.M., Peebles C.R., Thomas M.V. (1995). "Parasites of the round goby, Neogobius melanostomus, and tubenose goby, Proterorhinus marmoratus (Perciformes: Gobiidae), from the St. Clair River and Lake St. Clair, Michigan". J. Helminthol. Soc. Wash. 62 (2): 226–228. 
  30. ^ Pronin N.M., Fleischer G.W., Baldanova D.R., Pronina S.V. (1997). "Parasites of the recently established round goby (Neogobius melanostomus) and tubenose goby (Proterorhinus marmoratus') (Gobiidae) from the St. Clair River and Lake St. Clair, Michigan, USA". Folia Parasitol. 44: 1–6. 
  31. ^ Kvach, Y.; Stepien, C. A. (2008). "Metazoan Parasites of Introduced Round and Tubenose Gobies in the Great Lakes: Support for the "Enemy Release Hypothesis"". Journal of Great Lakes Research 34: 23. doi:10.3394/0380-1330(2008)34[23:MPOIRA]2.0.CO;2.  edit
  32. ^ Kvach, Y.; Stepien, C. A. (2008). "The invasive round goby Apollonia melanostoma (Actinopterygii: Gobiidae) - a new intermediate host of the trematode Neochasmus umbellus (Trematoda: Cryptogonimidae) in Lake Erie, Ohio, USA". Journal of Applied Ichthyology 24: 103. doi:10.1111/j.1439-0426.2007.01024.x.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!