Overview

Comprehensive Description

Description

Common names: shark (English), hornshark (English), tiburón (Espanol)
 
Heterodontus francisci (Girard, 1855)

Horn shark     Pacific horn-shark

Head high, conical; snout piglike; mouth small, anterior; a low bony ridge above each eye that ends abruptly at rear; space between eyes deeply concave; nasal grooves before mouth; front teeth on both jaws with 1 large central point and a small point at each side on base of tooth; 5 gill slits, first enlarged, 2-3 over pectoral fin; 2 dorsal fins, each with spine at front; first dorsal fin origin over pectoral base; skin denticles on flank small (~ 200/cm2  in adults) and smooth.


Dark to light grey, back and sides with small dark spots < 1/3 eye diameter; no light bar between eyes; small darks spots on a dusky patch below eye; young brightly colored, with dark saddles.


Size: 122 cm.

Habitat: rocky and sandy habitats, and macroalgal beds.

Depth: 1-150 m, usually 2-11 m.

California to the western and NE Gulf of California; possibly Ecuador and Peru.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Sluggish, nocturnal, and mostly solitary species. Inhabit rocky bottoms, kelp beds, sandy draws between rocks, on sand flats, deep crevices and small caves and also large underwater caverns. Adults tend to return to the same resting place every day (Ref. 43278). Feed on benthic invertebrates, especially sea urchins, crabs and probably abalone, also fishes. Oviparous (Ref. 50449). May bite back when harassed. Has broad muscular paired fins used as limbs for clambering on the bottom. Catch reduced to fish meal; fin spines used in production of jewels.
  • Compagno, L.J.V. 2001 Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 2001. 269p. (Ref. 43278)   http://www.fishbase.org/references/FBRefSummary.php?id=43278&speccode=2534 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

In the US, it is most common off southern California but ranges to Monterey Bay and may occasionally penetrate as far north as San Francisco Bay (where it is not resident) during northern influxes of warm water (Compagno 2001). In Mexico, it occurs off Baja California, in the Gulf of California and slightly further south.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Heterodontus francisci lives in warm-temperate and subtropical regions of the eastern Pacific. It is mainly found inhabiting the coastal areas from Southern California to the Gulf of California and also areas around Ecuador and Peru (Compagno 1984).

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

California, East Pacific, Ecuador, FAO fishing area 77, FAO fishing area 87, Mexico, Peru, San Francisco
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138597 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 150 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: central California, USA to the Gulf of California, and probably Ecuador and Peru.
  • Compagno, L.J.V. 2001 Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 2001. 269p. (Ref. 43278)   http://www.fishbase.org/references/FBRefSummary.php?id=43278&speccode=2534 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The horn shark gets its name because it has a short, blunt head with high ridges above the eyes (Castro 1983). Heterodontus francisci range in size from approximately 97cm to 120cm (Compagno 1984). They are a brownish color covered in black spots and their underbellies have a yellowish tint (Compagno 1984; Castro 1983).

Range mass: 0 to 0 kg.

Average mass: 10 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 122.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1220 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

122 cm TL (male/unsexed; (Ref. 247)); max. reported age: 12 years (Ref. 72467)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The horn shark is a common small warm temperate to subtropical benthic endemic shark. It is found on the continental shelf from the intertidal zone out to a depth of 152 m, although it is most common at a depth of 2 to 11 m. During the winter, horn sharks migrate into deeper waters, usually below 30 m. They exhibit a high degree of segregation corresponding to their life history. Adolescent sharks (between 35 to 48 cm) tend to remain in deeper water, usually between 40 to 150m, and as they mature they migrate back into relatively shallow water. This segregation of habitat by size and stage of maturity reduces competition for food and habitat between younger and older sharks. Habitat also changes ontogenetically, with juveniles inhabiting sandy bottoms with little vertical relief and adults inhabiting rocky reefs with caves and crevices, or areas of thick algae cover. Juveniles use bat ray Myliobatis californica feeding pits in sandy areas as shelter and foraging areas. Adults that occur in the algal habitat have noticeably longer fin spines than those in the reef habitat. This is due to their spines being worn down by going in and out of caves. Horn sharks show distinct diel patterns of activity, which is controlled by light intensity. Adults are relatively inactive diurnally, but are very active nocturnally. They are site specific, returning to the same resting place at dawn and remaining there until the evening. They have a small home range, usually no larger than 1,000 m², and they long-term site fidelity as sharks have been recovered in their tagging locations after up to 11.25 years at liberty. The furthest distance a horn shark has been documented as traveling is 16.3 km. Water temperature is an important factor controlling the relative abundance of the horn shark, as they prefer water over 70°F (Roedel and Ripley 1950, Nelson and Johnson 1970, Feder et al. 1974, Finstad and Nelson 1975, Strong 1989, Ebert 2003).

Horn sharks are oviparous, and females lay two eggs every 11 to 14 days usually between February and April, depositing up the 24 eggs in a single breeding season. Egg cases are usually laid in shallow water between 2 and 13 m deep. Development of embryos lasts 6 to 10 months, depending on temperature. Size at birth is 15 to 17 cm. Males mature at 56 to 61 cm and reach a maximum length of 83cm, while females over 58 cm are mature, with a maximum length of 96 cm, but possibly up to 120 cm. Very little is known about age and growth of this species. Growth rates are generally slow and very variable, and they do not correspond to size. The unconfirmed maximum age is 25 years (Roedel and Ripley 1950, Dempster and Herald 1961, Eschmeyer et al. 1983, Michael 1993, Compagno et al. 1995, Ebert 2003).

Horn sharks feed on a wide variety of benthic invertebrates and on small teleosts. Adults prey upon gastropods, crabs, shrimp, squid, sea urchins, sea stars, and small teleosts, namely the blacksmith Chromis punctipinna. Juveniles feed on polychaetes, small clams, and sea anemones in addition to opportunistically feeding on squid and small teleosts when available (Roedel and Ripley 1950, Feder et al. 1974, Strong 1989, Compagno 2001, Ebert 2003).

Life history parameters
Age at maturity (years): Unknown (male and female).
Size at maturity (total length): Female: >58 cm (Compagno et al. 1995); Male: 56 to 61 cm (Strong 1989).
Longevity: 25 years (unconfirmed) (Michael 1993).
Maximum size (total length): Female: 96 cm, possibly up to 120 cm; Male: 83 cm (Roedel and Ripley 1950, Feder et al. 1974).
Size at birth : 15 to 17 cm (Compagno et al. 1995, Ebert 2003).
Average reproductive age (years): Unknown.
Gestation time: 6 to 10 months (Dempster and Herald 1961, Ebert 2003).
Reproductive periodicity: Unknown.
Average annual fecundity or litter size: 24 eggs in a single breeding season (Ebert 2003).
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Horn sharks live in temperate waters in the Eastern Pacific. They dwell along the water bottom frequently in kelp beds laying 8-12 meters deep. Horn Sharks have been found in caves as deep as 200 meters, but usually they remain at much shallower depths (Castro 1983).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

A common benthic and epibenthic shark, found on the eastern Pacific continental shelf most abundantly at depths from 2 to 11 m but ranging from the intertidal down to at least 150 m. Found on rocky bottoms including reefs, kelp beds, sandy draws between rocks, and on sand flats. On rocks it often occurs in deep crevices and small caves, and ventures far into large underwater caverns
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138597 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 2 - 15
  Temperature range (°C): 20.376 - 21.311
  Nitrate (umol/L): 0.133 - 0.264
  Salinity (PPS): 34.228 - 34.249
  Oxygen (ml/l): 5.018 - 5.091
  Phosphate (umol/l): 0.352 - 0.397
  Silicate (umol/l): 3.264 - 3.341

Graphical representation

Depth range (m): 2 - 15

Temperature range (°C): 20.376 - 21.311

Nitrate (umol/L): 0.133 - 0.264

Salinity (PPS): 34.228 - 34.249

Oxygen (ml/l): 5.018 - 5.091

Phosphate (umol/l): 0.352 - 0.397

Silicate (umol/l): 3.264 - 3.341
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 150m.
From 2 to 150 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 2 - 150 m (Ref. 9253), usually 2 - 11 m (Ref. 9253)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of horn sharks consists mainly of small fishes and invertebrates. Heterodontus francisci have been known to eat many types of small fish; however, their chief staples are mollusks, sea urchins, and crustaceans. Since horn sharks are fairly inactive they prefer to wait for their prey to swim by before attacking it and feasting. But they won't necessarily lie still waiting for food to come by (Compagno 1984; Castro 1983; Stevens 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sluggish, nocturnal, and mostly solitary species. Inhabits rocky bottoms, kelp beds, sandy draws between rocks, on sand flats, deep crevices and small caves and also large underwater caverns. Adults tend to return to the same resting place every day (Ref. 43278). Feeds on benthic invertebrates, especially sea urchins, crabs and probably abalone, also fishes. Also in Ref. 9137.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 205). Distinct pairing with embrace (Ref. 205). Courtship starts when the male chases the female, then when both are ready, they drop to the bottom (Ref. 43278). During courtship and prior to copulation, the male bites and wraps its body to the female pectoral fin, body, tail, and gills (Ref. 51127, 49562). The male then inserts a single clasper in the female's cloaca; copulation lasts 30 to 40 min. After one or two weeks later, the eggs are laid in about 11 to 14 intervals for 4 months which were deposited under rocks or in crevices, as was observed in nature. In captivity, the female drops the eggs on the bottom where the contents of the egg cases maybe eaten by these sharks; the eggs are hatched in 7 to 9 months. The young begin to feed one month after hatching (Ref. 43278).
  • Compagno, L.J.V. 2001 Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 2001. 269p. (Ref. 43278)   http://www.fishbase.org/references/FBRefSummary.php?id=43278&speccode=2534 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Horn sharks mate in the months of December and January. "The male horn shark chases the female until the latter is ready, then both drop to the (ocean) bottom. The male grabs the female's pectoral fin with his teeth and inserts a single clasper in her cloaca; copulation lasts 30 to 40 minutes" (Compagno 1984). A few weeks after copulation, the female will deposit the fertilized eggs amongst the rocks where they will hatch anywhere from 6-9 months later. The young sharks, when first born, will be roughly 15-17cm in length (Castro 1983; Compagno 1984; Stevens 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Benthic, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heterodontus francisci

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1532-06|NC_003137|Heterodontus francisci| AATCGTTGACTATTTTCTACAAACCACAAAGATATCGGCACCCTATATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGAACAGCTTTA---AGCTTACTTATCCGAGCTGAACTAAGTCAGCCTGGATCCCTCCTAGGTGAT---GATCAAATCTATAATGTTATTGTGACTGCCCATGCTTTCGTAATAATCTTTTTTATAGTTATGCCTGTAATAATTGGAGGATTTGGCAATTGACTTGTTCCACTAATA---ATTGGTGCCCCCGACATGGCCTTCCCACGAATAAATAACATAAGCTTTTGACTTCTCCCACCCTCTTTTCTCTTACTCCTAGCTTCAGCTGGAGTCGAAGCAGGAGCTGGAACTGGCTGAACAGTTTACCCCCCTTTAGCTGGTAACCTAGCCCATGCCGGAGCGTCCGTGGACTTA---GCAATCTTTTCCTTACACTTAGCTGGTATTTCATCAATCTTAGCTTCAATTAACTTTATTACAACCATTATTAACATAAAACCCCCAGCCATCTCCCAATACCAAACACCCTTATTTGTTTGATCAATTCTTGTAACCACCATCCTCCTCTTACTATCACTTCCTGTTTTAGCAGCT---GGAATTACAATACTACTAACCGACCGTAATCTAAATACAACATTCTTTGACCCCGCTGGCGGAGGAGATCCTATTTTATACCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTATATATTCTAATCCTACCAGGCTTTGGAATAATTTCACATGTAGTAGCTTATTATTCAGGAAAAAAA---GAACCATTCGGTTATATAGGAATAGTCTGAGCAATAATAGCAATCGGACTACTAGGCTTTATTGTCTGAGCCCACCACATATTTACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Heterodontus francisci

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 9
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Carlisle, A.B.

Reviewer/s
Cavanagh, R.D. & Fowler, S.L. (Shark Red List Authority)

Justification
Heterodontus francisci is a benthic shark, endemic to the warm temperate to subtropical waters on the Pacific continental shelf off Mexico and the US, and probably off Ecuador and Peru. This shark occurs from the intertidal zone to a depth of 152 m, although is most common at 2 to 11 m, moving offshore in the winter to waters >30 m. The species exhibits a high degree of segregation corresponding to its life history, with adults occurring shallower than juveniles. Horn sharks have a small home range and exhibit long term site fidelity. They are hardy species and can survive capture if returned to the water; however, catches in Mexico are sometimes left to die on beaches. They are of no commercial value, although they are taken as bycatch (primarily off Mexico). If the gillnet fishery in Mexico expands significantly in the future, the population could potentially face problems, however, insufficient information is available at present to assess Heterodontus francisci beyond Data Deficient. However, it could well be Least Concern in US waters where its capture in fisheries is extremely rare with no other apparent threats.

History
  • 2000
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Horn sharks are not an endangered species. Therefore, they have no special status. They have been known to vacate certain areas with a high number of divers. But as long as divers don't drastically increase all along the Eastern Pacific Coast horn sharks should remain off the endangered species list.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation status

IUCN Red List: Listed, Data deficient

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Rare north of southern California. Occurs year-round in San Ignacio Lagoon, Mexico with lower abundance in summer and fall (Segura-Zarzosa et al. 1997). Differences in egg case morphology between the Channel Islands, California and the mainland suggest that they may be separate populations (Ebert 2003).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In California horn sharks are of no commercial value. They are taken as bycatch in traps and trawls and occasionally by recreational anglers. In Mexico they are caught as a bycatch of the shrimp fishery and other bottom-trawling operations. Caught as bycatch in the demersal gillnet fishery in the northern Gulf of Mexico and likely on the Pacific side of Baja California during the winter and spring. The Mexican population could have problems in the future if the gillnet fishery expands (Wade Smith, pers comm). They have been captured by divers for sport and for the large fin spines, which are made into jewellery; decreases in numbers of horn sharks have been noted in areas with intense diver activity in Southern California. Horn sharks are often harassed and grabbed by divers, but when provoked may swim after their assailants and bite them. These sharks are kept in many public aquaria in the US. They are hardy, attractive, readily maintained, will breed in captivity, and have been displayed for many years (Compagno 2001, Ebert 2003).

Utilization
Captured as bycatch, large sharks are eaten, but smaller ones are discarded. They have also been captured by divers for sport and for the large fin spines, which are made into jewellery. Also utilized (non-consumptive) for display in public aquaria in the US. In Mexico these sharks are probably utilized (or formerly utilized) for fishmeal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Like other hornsharks, Heterodontus francisci is a hardy species and can survive capture in drift and trawl nets. Individuals should be returned to the water if alive after capture.

Further information on distribution, population structure and biology is required.

The development and/or implementation of National Shark Plans under the FAO IPOA-Sharks, where necessary.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Horn sharks do not have any negative effect on humans. They will not even attack humans, prefering to flee if a person comes near (Stevens 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The horn shark does not have a great deal of commercial value. Some people catch them "for sport and for its large fin spines, which are made into jewelry" (Compagno 1994, p. 157). However the most important value of Heterodontus francisci comes from research. These sharks have been known to survive in captivity for as many as twelve years where scientists study them (Castro 1983). This is important because most sharks die shortly after they are placed into captivity; usually because they stop eating. Therefore, the horn shark proves quite valuable to scientists wishing to study sharks (Compagno 1984; Castro 1983; Stevens 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: minor commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Horn shark

The horn shark (Heterodontus francisci) is a species of bullhead shark, family Heterodontidae. It is endemic to the coastal waters off the western coast of North America, from California to the Gulf of California. Young sharks are segregated spatially from the adults, with the former preferring deeper sandy flats and the latter preferring shallower rocky reefs or algal beds. A small species typically measuring 1 m (3.3 ft) in length, the horn shark can be recognized by a short, blunt head with ridges over its eyes, two high dorsal fins with large spines, and a brown or gray coloration with many small dark spots.

Slow-moving, generally solitary predators, horn sharks hunt at night inside small home ranges and retreat to a favored shelter during the day. Their daily activity cycles are controlled by environmental light levels. Adult sharks prey mainly on hard-shelled molluscs, echinoderms, and crustaceans, which they crush between powerful jaws and molar-like teeth, while also feeding opportunistically on a wide variety of other invertebrates and small bony fishes. Juveniles prefer softer-bodied prey such as polychaete worms and sea anemones. The shark extracts its prey from the substrate using suction and, if necessary, levering motions with its body. Reproduction is oviparous, with females laying up to 24 eggs from February to April. After laying, the female picks up the auger-shaped egg cases and wedges them into crevices to protect them from predators.

Horn sharks are harmless unless harassed, and are readily maintained in captivity. They are not targeted by either commercial or recreational fisheries, though small numbers are caught as bycatch. In Mexico this species is used for food and fishmeal, and in California its spines are made into jewelry. The International Union for Conservation of Nature (IUCN) does not yet have enough information to determine the horn shark's conservation status. It faces few threats off the coast of the United States.

Contents

Taxonomy

The French biologist Charles Frédéric Girard published the first scientific description of the horn shark under the name Cestracion francisci in 1855, in the Proceedings of the Academy of Natural Sciences of Philadelphia.[2] This species was later placed in the genus Gyropleurodus, which was eventually synonymized with the genus Heterodontus. The specific epithet francisci is a reference to San Francisco, although the range of the horn shark does not extend that far north.[3] The type specimen from Monterey Bay has since been lost. The scientific name for this species has been given erroneously as Heterodontus californicus.[2]

Distribution and habitat

Unlike the adults, juvenile horn sharks prefer a flat, sandy habitat.

The horn shark inhabits the continental shelf of the eastern Pacific Ocean, occurring off the coasts of California and Baja California from Monterey Bay southward, and in the Gulf of California. Uncommon influxes of warm water northward may bring it as far as San Francisco Bay.[2] There are unconfirmed reports of this species off Ecuador and Peru, which may be misidentifications of other species.[1]

For most of the year, horn sharks are most common at a depth of 2–11 m (6.6–36 ft). At the onset of winter, they migrate to water deeper than 30 m (98 ft).[3] This species has been found in caves as deep as 200 m (660 ft). Juvenile horn sharks between 35–48 cm (1.15–1.57 ft) long prefer sandy flats with low vertical relief, in water 40–150 m (130–490 ft) deep. They often take advantage of large feeding pits excavated by the bat ray (Myliobatis californica) for shelter and food. As they mature, horn sharks shift into shallower water and their preferred habitat becomes structurally complex rocky reefs or algae beds.[4] This strongly benthic species seldom ventures more than 2 m (6.6 ft) above the substrate.[3]

The relative abundances of the horn shark and the swellshark (Centroscyllim ventriosum), which shares the same habitat, are negatively correlated, because horn sharks favor water over 20 °C (70°F) while swellsharks are more tolerant of cold. At Santa Catalina Island, a 20-year warming trend has resulted in an increase in the horn shark population and a decrease in the swellshark population. Horn sharks are less common than swellsharks in the northern Channel Islands, where the water is cooler.[3]

Description

The horn shark has a distinctively shaped head with prominent ridges above its eyes.

Like other bullhead sharks, the horn shark has a short, wide head with a blunt snout and prominent supraorbital ridges over the eyes. The horn shark's supraorbital ridges are low and terminate abruptly; the space between them on top of the head is deeply concave. Each eye lacks a nictating membrane and is followed by a tiny spiracle. The nostrils are split into inflow and outflow openings by a long flap that reaches the mouth. The inflow openings are encircled by a groove, while another groove connects the outflow openings to the mouth. The mouth is small and curved, with prominent furrows at the corners. There are 19–26 tooth rows in the upper jaw and 18–29 tooth rows in the lower jaw. The teeth at the front of the jaws are small and pointed, with a central cusp flanked by a pair of lateral cusplets; those at the sides of the jaws are much larger, elongated lengthwise, and molar-like.[2][3]

The body is cylindrical, with two high, somewhat falcate (sickle-shaped) dorsal fins bearing stout spines at the front.[2] The fin spines of reef-dwelling horn sharks are shorter than those living in algal habitats, as their spines become worn down on rocks from the sharks' movements.[3] The first dorsal fin originates over the bases of the large pectoral fins, while the second dorsal fin originates slightly anterior to the free rear tips of the pelvic fins. The caudal fin has a short lower lobe and a long, broad upper lobe with a strong notch near the tip. The horn shark's dermal denticles are small and smooth, numbering some 200/cm2 on the back in adults.[2] The dorsal coloration consists of various shades of gray or brown with many small dark spots, though these may be absent in older sharks; the underside is yellowish. There is a dark patch of small spots below the eye.[2][3] This species may reach a length of 1.2 m (3.9 ft), though most individuals do not exceed 1 m (3.3 ft).[4]

Biology and ecology

Horn sharks rest during the day and only become active at night.

The horn shark is a clumsy, sporadic swimmer that prefers to use its flexible, muscular pectoral fins to push itself along the bottom. It is usually solitary, though small groups have been recorded.[2] During the day, horn sharks rest motionless, hidden inside caves or crevices, or within thick mats of algae, though they remain relatively alert and will swim away quickly if disturbed. After dusk, they roam actively above the reef in search of food.[5] Horn sharks maintain small home ranges of around 1,000 m2 (11,000 sq ft), which they may remain faithful to for over a decade, returning to the same shelter every day. The shelter is usually located at the edge of the resident shark's foraging area.[3] The longest documented movement for an individual horn shark is 16 km (9.9 mi).[4]

Unlike most fishes, the daily activity pattern of the horn shark is under exogenous control, meaning that it is regulated by environmental factors rather than by an internal physiological cycle. Observations of captive horn sharks show that the relevant cue is light intensity: the sharks become active immediately after the lights are turned off, and stop as soon as they are turned back on. In one experiment where the sharks were kept in darkness, they remained continuously active for 11 days before slowing, possibly from fatigue. In nature, horn sharks exposed to a bright light at night may stop swimming and sink to the bottom.[5]

The horn shark is preyed upon by larger fishes and the northern elephant seal (Mirounga angustirostris), which consumes adults, juveniles, and egg cases. In addition, they are captured and eaten by bald eagles (Haliaeetus leucocephalus) at Catalina Island, and large marine snails are able to drill into their egg cases to extract the yolk.[6] The tough skin and spines of this species confer some protection; a Pacific angelshark (Squatina californica) has been filmed engulfing a juvenile horn shark, only to spit it out due to its spines.[2] Known parasites of this species include the tapeworms Acanthobothrium bajaensis and Acanthobothrium puertecitense, the copepod Trebius heterodonti, and the nematode Echinocephalus pseudouncinatus, which spends its larval stage inside potential prey such as scallops and sea urchins.[7][8][9][10]

Feeding

Sea urchins are a favored prey of the horn shark.

Some 95% of the adult horn shark's diet consists of hard-shelled molluscs (e.g. bivalves and gastropods), echinoderms (e.g. sea urchins) and crustaceans (e.g. crabs, shrimp, and isopods). To crack their shells, the horn shark generates the highest known bite force relative to its size of any shark, well in excess of other measured species such as the spiny dogfish (Squalus acanthias) and the blacktip shark (Carcharhinus limbatus).[11] One study found the average bite force for this species in the wild to be 95 N with a maximum of 135 N, while under experimental conditions sharks could be induced to bite with over 200 N of force.[11] Large horn sharks that feed mainly on sea urchins (particularly the short-spined purple urchin, Strongylocentrotus purpuratus) have their teeth and fin spines stained purple.[3]

Other prey items of adults include peanut worms, sea stars, cephalopods, and small bony fishes. Juveniles feed primarily on polychaete worms, sea anemones, and small clams, and have been known to "pounce" on anemones to bite off tentacles before they can be retracted. Off southern California, horn sharks are known to take advantage of seasonal opportunities. In the summer, diurnally active fishes, in particular the blacksmith (Chromis punctipinnis), are especially abundant and are easily captured at night when they lie dormant. In the winter, the sharks scavenge on market squid (Loligo opalescens), which die by the tens of thousands after their mass spawning event.[3][6] Horn sharks hunt mainly using their sense of smell.[4] Although electroreception certainly plays a role in locating prey, this species has only 148 ampullae of Lorenzini. This is much fewer than in most other sharks, which may have over 2,000.[12] Like other sharks, the horn shark's teeth are regularly replaced; it takes 4 weeks for a dropped tooth to be replaced.[13]

The horn shark captures prey via suction, created by expanding its buccal cavity. Its labial cartilages are modified so that the mouth can form a tube, facilitating the suction force. Once the prey is drawn into the mouth, it is secured with the sharp front teeth and then ground into pieces by the flat lateral teeth. To extract buried or affixed prey, the horn shark grips it and adopts a vertical posture with the head and pectoral fins against the substrate and the tail arched above. The shark then acts as a lever with its pectoral fins as the fulcrum: with a downward stroke of the tail, it forces its head upwards and pulls the prey loose; this mode of feeding has not been observed in any other shark. The horn shark is also capable of protruding its upper jaw up to 15% the length of its head; this motion takes only 20 milliseconds to accomplish and allows the shark to use its upper jaw like a chisel to dislodge firmly attached prey.[14]

Life history

The spiral-flanged egg case of a horn shark; the shape allows the egg to be secured within crevices.

Mating in the horn shark occurs in December or January, on a possibly annual reproductive cycle.[15] The male chases the female to indicate interest; once she is ready both sharks settle on the bottom, where the male grips the female's pectoral fin in his teeth and inserts one of his claspers into her cloaca. After 30–40 minutes of copulation, the pair disengages and the female spins with her snout in the sand for another 30 minutes.[6] From February to April, the females lay a maximum of 24 eggs two at a time once every 11–14 days, in water 2–13 m (6.6–43 ft) deep.[1] The egg case has two flanges spiraling around it, and thus may take the female several hours to deposit.[16] At first the case is soft and light brown, and over a few days it hardens and darkens in color. Not including the flanges, the case measures 10–12 cm (3.9–4.7 in) long and 3–4 cm (1.2–1.6 in) wide; sharks from the Channel Islands produce longer egg cases than those from mainland California, suggesting that they are separate populations.[2][3]

One of the few sharks to exhibit parental care, female horn sharks in the wild pick up their eggs in their mouths and wedge them into crevices.[3] However, in captivity the eggs are simply dropped on the bottom and may later be cannibalized.[2] The eggs hatch in 6–10 months; at emergence the young measure 15–17 cm (5.9–6.7 in) long.[1] Newly hatched sharks are provisioned with an internal yolk sac and do not have to feed until they are a month old, though they are capable of feeding and will accept food during this period. Horn sharks grow slowly and at a highly variable rate that does not correspond to their size; this has frustrated attempts to determine their aging process.[3] Males mature at a length of 56–61 cm (22–24 in) and females at a length of at least 58 cm (23 in).[1] Individual sharks have lived to over 12 years old in captivity, and there exists an unconfirmed report of a shark reaching 25 years of age.[3]

Human interactions

Horn sharks are innocuous towards humans.

Under normal circumstances, horn sharks are harmless to humans and can readily be approached underwater.[3] However, they can be provoked into biting, and some pugnacious individuals have been known to chase and bite divers after being harassed.[6] These sharks should be handled with care as their fin spines can inflict a painful wound.[3] The horn shark adapts well to captivity and has been maintained and bred in many public aquariums across the United States.[2]

The horn shark has no commercial value in California, where it is captured unintentionally in traps and trawls and by recreational anglers. The shark's hardiness ensures that it can often be returned to the water alive.[1] This species benefits from general restrictions placed on coastal fishing gear by the State of California. The average annual bycatch off California is 1,800 kg (4,000 lb), though historically it has varied from 2.5 kg (5.5 lb) in 1976 to 9,500 kg (21,000 lb) in 1979.[15] Divers sometimes kill them for sport or to make jewelry out of their fin spines, which may be the cause of a decline in the numbers of horn sharks in the most intensely dived areas of southern California. Off Mexico, this species is caught incidentally in shrimp trawls and demersal gillnets, and used for human consumption and fishmeal. The expansion of Mexican gillnet fisheries may pose a conservation concern in the future. At present, the International Union for Conservation of Nature (IUCN) does not have sufficient information to assess the overall conservation status of this species; its status in United States waters is likely Least Concern.[1]

References

  1. ^ a b c d e f g Carlisle, A.B. (2005). Heterodontus francisci. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on June 19, 2009.
  2. ^ a b c d e f g h i j k l Compagno, L.J.V. (2002). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date (Volume 2). Rome: Food and Agriculture Organization. pp. 36–37. ISBN 92-5-104543-7. 
  3. ^ a b c d e f g h i j k l m n o p Ebert, D.A. (2003). Sharks, Rays, and Chimaeras of California. University of California Press. pp. 81–86. ISBN 0-520-23484-7. 
  4. ^ a b c d Buch, R. Biological Profiles: Horn Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on June 18, 2009.
  5. ^ a b Nelson, D.R. and Johnson, R.H. (December 12, 1970). "Diel Activity Rhythms in the Nocturnal, Bottom-Dwelling Sharks, Heterodontus francisci and Cephaloscyllium ventriosum". Copeia (American Society of Ichthyologists and Herpetologists) 1970 (4): 732–739. doi:10.2307/1442315. JSTOR 1442315. 
  6. ^ a b c d Martin, R.A. Kelp Forests: Horn Shark. ReefQuest Centre for Shark Research. Retrieved on June 19, 2009.
  7. ^ Appy, R.G. and Dailey, M.D. (October 1973). "Two New Species of Acanthobothrium (Cestoda: Tetraphyllidea) from Elasmobranchs of the Eastern Pacific". The Journal of Parasitology (The American Society of Parasitologists) 59 (5): 817–820. doi:10.2307/3278414. JSTOR 3278414. 
  8. ^ Caira, J.N. and Zahner, S.D. (November 2001). "Two new species of Acanthobothrium Beneden, 1849 (Tetraphyllidea: Onchobothriidae) from horn sharks in the Gulf of California, Mexico". Systematic Parasitology 50 (3): 219–229. doi:10.1023/A:1012241913722. 
  9. ^ Deets, G.B. and Dojiri, M. (March 1989). "Three species of Trebius Krøyer, 1838 (Copepoda: Siphonostomatoida) parasitic on Pacific elasmobranchs". Systematic Parasitology 13 (2): 81–101. doi:10.1007/BF00015217. 
  10. ^ Anderson, R.C. (2000). Nematode Parasites of Vertebrates: Their Development and Transmission. CABI. p. 389. ISBN 0-85199-421-0. 
  11. ^ a b Huber, D.R., Eason, T.G., Hueter, R.E. and Motta, P.J. (2005). "Analysis of the bite force and mechanical design of the feeding mechanism of the durophagous horn shark Heterodontus francisci". Journal of Experimental Biology 208 (Pt 18): 3553–3571. doi:10.1242/jeb.01816. PMID 16155227. http://jeb.biologists.org/cgi/content/full/208/18/3553. 
  12. ^ Bullock, T.H., Hopkins, C.D., Popper, A.N. and Fay, R.R. (2005). Electroreception. Birkhäuser. p. 49. ISBN 0-387-23192-7. 
  13. ^ Reif, W. (1976). "Morphogenesis, pattern formation and function of the dentition of Heterodontus (Selachii)". Zoomorphologie 83: 1–47. doi:10.1007/BF00995429. 
  14. ^ Edmonds, M.A., Motta, P.J. and Hueter, R.E. (2001). "Food capture kinematics of the suction feeding horn shark, Heterodontus francisci". Environmental Biology of Fishes 62 (4): 415–427. doi:10.1023/A:1012205518704. 
  15. ^ a b Fowler, S.L., Cavanagh, R.D., Camhi, M., Burgess, G.H., Cailliet, G.M., Fordham, S.V., Simpfendorfer, C.A. and Musick, J.A. (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. International Union for Conservation of Nature and Natural Resources. pp. 237–238. ISBN 2-8317-0700-5. 
  16. ^ Martin, R.A. Heterodontiformes: Bullhead Sharks. ReefQuest Centre for Shark Research. Retrieved on June 19, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!