Overview

Comprehensive Description

Biology

Adults inhabit the sea for an undetermined period and are parasitic on fishes; enter freshwater to breed. Majority of adulthood is spent in estuaries or at sea. Upstream spawning migrants occur in fast-flowing sections of rivers with a mud, sand or silt substrate, sometimes seen congregated below barriers to upstream movement such as weirs. Ammocoetes live in slow-flowing streams, burrowed in mud or silt. Common length is 35-40 cm (Ref. 44894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southern Ocean: Southeastern Australia from Shoalhaven River, New South Wales to Gulf of St. Vincent, South Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southeastern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 5259))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mordacia mordax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTCGGGGCTTGAGCAGGAATAGTAGGAACAGCATTAAGCATTCTAATCCGAGCAGAACTAAGTCAACCAGGAACGCTCCTAGGTGATGATCAAATCTACAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATGGTAATACCCATCATAATAGGAGGCTTTGGGAATTGATTAACTCCTTTAATACTAGGTGCCCCAGATATAGCATTTCCTCGAATAAATAACATAAGTTTCTGACTTCTCCCTCCTTCCCTCCTTCTTCTCTTAGCATCTTCAGGTGTTGAAGCAGGAGTAGGTACAGGCTGAACAGTCTATCCACCACTAGCAGGAAACTTAGCTCACACAGGAGCCTCTGTAGACTTGGCCATCTTTTCCCTACACCTTGCAGGTGTGTCATCAATTTTAGGAGCCATTAATTTTATCACAACTATTTTCAACATAAAACCCCCAACTATAACTATATATCACGTACCACTATTTATTTGATCAGTGTTAATTACAGCTGTTCTTCTTCTTCTTTCACTCCCAGTTTTAGCCGCAGCTATTACAATACTACTAACAGACCGTAATCTAAATACAACCTTCTTTGACCCAGCAGGTGGAGGAGACCCTATCTTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mordacia mordax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mordacia mordax

Mordacia mordax, known as the short-headed lamprey, Australian lamprey or Murray lamprey, is a species of southern topeyed lamprey that occurs in south-eastern Australia. It has a thin eel-like body up to 50 cm long, with two low dorsal fins on the back half. The skin is blue-gray or brown. Its eyes are small, and located on the top of its head.

Adult Mordacia mordax live at sea and are parasites on other fish. They breed in fresh water, however, migrating up streams in southeastern Australia from Shoalhaven River, New South Wales to Gulf St Vincent, South Australia. The ammocoetes (lamprey larvae) remain in fresh water until metamorphosis, usually migrating to the sea around three to four years after hatching.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!