Overview

Comprehensive Description

Biology

Adults inhabit the sea for an undetermined period and are parasitic on fishes; enter freshwater to breed. Majority of adulthood is spent in estuaries or at sea. Upstream spawning migrants occur in fast-flowing sections of rivers with a mud, sand or silt substrate, sometimes seen congregated below barriers to upstream movement such as weirs. Ammocoetes live in slow-flowing streams, burrowed in mud or silt. Common length is 35-40 cm (Ref. 44894). Larval life is 3.5 yrs. During the spawning migration, adults burrow in the substrate of rivers during the day and migrate upstream during the night. Fecundity, 3,789-13,372 eggs/female. De Castelnau (1872) states that the adults from the lower Yarra River, Victoria, are considered good food (Ref. 89241).
  • Allen, G.R. 1989 Freshwater fishes of Australia. T.F.H. Publications, Inc., Neptune City, New Jersey. (Ref. 5259)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southern Ocean: Southeastern Australia from Shoalhaven River, New South Wales to Gulf of St. Vincent, South Australia.
  • Allen, G.R. 1989 Freshwater fishes of Australia. T.F.H. Publications, Inc., Neptune City, New Jersey. (Ref. 5259)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 5259))
  • Allen, G.R. 1989 Freshwater fishes of Australia. T.F.H. Publications, Inc., Neptune City, New Jersey. (Ref. 5259)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adults: 11.3-43.2 cm TL; body proportions of pre-spawning specimens, as percentage of TL (based on 125 prespawning specimens measuring 11.3-42.1 cm TL): 8.5-11.3 prebranchial length, 7.1-9.8 branchial length, 60.4-68.3 trunk length, 14.4-20.1 tail length, 1.1-1.7 eye length and 4.9-6.6 disc length. Body proportions of spawning male specimens, as percentage of TL (based on 8 spawning males measuring 27.7-37.6 cm TL): 11.4-16.6 prebranchial length, 8.8-10.1 branchial length, 60.1-65.3 trunk length, 13.3-15.7 tail length, 8.1-11.2 disc length. Mature males with some loose skin in gular region. Urogenital papilla not prominent in mature adults; trunk myomeres, 84-96. Adult dentition: 2 triangular supraoral laminae each with 3 unicuspid teeth, 1 per apex; infraoral lamina, 7-9 unicuspid teeth of various size (these teeth become greatly enlarged with sexual maturation); 5-7 endolateral plates on either side each bearing 2-3 unicuspid teeth, usually 3; endolateral formula, typically 2-3-3-3-3-3 in immature individuals and 5-7 individual cusps on either side in mature individuals; 1 row of anterials; first row of anterials, 2 unicuspid teeth plus 1-2 bicuspid teeth or 3 unicuspid teeth flanked on either side by 1 bicuspid tooth; 1 row of exolaterals on each side; 1 row of posterials; first row of posterials, 12-14 posterial plates, the 2-4 lateralmost tricuspid and the internal ones bicuspid in immature individuals and 12-14 unicuspid teeth in mature individuals; transverse lingual lamina w-shaped, with 29 unicuspid teeth, the median one and the 2 subterminal ones slightly enlarged; longitudinal lingual laminae interrupted j-shaped, each with an undetermined number of unicuspid teeth. Velar tentacles in adults, 3-4, smooth. Body coloration (live) of immature adults brownish gray on dorsal surface and silvery on ventral surface; lateral line neuromasts darkly pigmented; caudal fin pigmentation, 25% to
  • Renaud, C.B. 2011 Lampreys of the world. An annotated and illustrated catalogue of lamprey species known to date. FAO Species Catalogue for Fishery Purposes. No. 5. Rome, FAO. 109 pp. (Ref. 89241)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adults inhabit the sea for an undetermined period and are parasitic on fishes; enter freshwater to breed. Majority of adulthood is spent in estuaries or at sea. Upstream spawning migrants occur in fast-flowing sections of rivers with a mud, sand or silt substrate, sometimes seen congregated below barriers to upstream movement such as weirs. Ammocoetes live in slow-flowing streams, burrowed in mud or silt (Ref. 44894).
  • Renaud, C.B. 2011 Lampreys of the world. An annotated and illustrated catalogue of lamprey species known to date. FAO Species Catalogue for Fishery Purposes. No. 5. Rome, FAO. 109 pp. (Ref. 89241)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mordacia mordax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTCGGGGCTTGAGCAGGAATAGTAGGAACAGCATTAAGCATTCTAATCCGAGCAGAACTAAGTCAACCAGGAACGCTCCTAGGTGATGATCAAATCTACAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATGGTAATACCCATCATAATAGGAGGCTTTGGGAATTGATTAACTCCTTTAATACTAGGTGCCCCAGATATAGCATTTCCTCGAATAAATAACATAAGTTTCTGACTTCTCCCTCCTTCCCTCCTTCTTCTCTTAGCATCTTCAGGTGTTGAAGCAGGAGTAGGTACAGGCTGAACAGTCTATCCACCACTAGCAGGAAACTTAGCTCACACAGGAGCCTCTGTAGACTTGGCCATCTTTTCCCTACACCTTGCAGGTGTGTCATCAATTTTAGGAGCCATTAATTTTATCACAACTATTTTCAACATAAAACCCCCAACTATAACTATATATCACGTACCACTATTTATTTGATCAGTGTTAATTACAGCTGTTCTTCTTCTTCTTTCACTCCCAGTTTTAGCCGCAGCTATTACAATACTACTAACAGACCGTAATCTAAATACAACCTTCTTTGACCCAGCAGGTGGAGGAGACCCTATCTTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mordacia mordax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mordacia mordax

Mordacia mordax, known as the short-headed lamprey, Australian lamprey or Murray lamprey, is a species of southern topeyed lamprey that lives in south-eastern Australia. It has a thin eel-like body up to 50 cm long, with two low dorsal fins on the back half. The skin is blue-gray or brown. Its eyes are small, and located on the top of its head.

Adult Mordacia mordax live at sea and are parasites on other fish. They breed in fresh water, however, migrating up streams in southeastern Australia from Shoalhaven River, New South Wales to Gulf St Vincent, South Australia. The ammocoetes (lamprey larvae) remain in fresh water until metamorphosis, usually migrating to the sea around three to four years after hatching.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!