Articles on this page are available in 2 other languages: Spanish (1), Dutch (1) (learn more)

Overview

Brief Summary

The tope is a harmless inhabitant of the sea bottom, but it has sharp teeth. It eats fish, crustaceans, echinoderms and cuttlefish. The tope looks 'like what a shark is suppose to look like', with a pointed nose and a large dorsal fin. The species is being threatened by overfishing.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

This strong swimmer is an opportunistic predator that attacks schools of fish such as cod, herring, sardines and whiting (3) (4). Although it feeds primarily on bony fish, it also consumes bottom-dwelling animals such as crustaceans and molluscs (3). Tope themselves are prey for larger sharks such as the great white shark (Carcharodon carcharias) (4). Tope sharks occur in small schools that migrate long distances in the higher latitudes of their range where they move towards the equator in winter, and poleward in the summer (4). The schools are known to segregate by sex and age (4), making them especially vulnerable to the effects of fishing (6). Tope are ovoviviparous (4), a method of reproduction in which embryos develop within eggs that remain inside the mother's body until they hatch. No placenta is formed, and instead the embryo depends on its own egg yolk for nourishment (3). Gestation is thought to last for about 12 months, and females move inshore to coastal nursery areas in the late summer to give birth (3) (7). Between 6 and 52 pups are born in a litter (4), each measuring about 40 centimetres in length (3). Tope are believed to have a life expectancy of up to 55 years (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The tope shark, the only member of the genus Galeorhinus, is a large, slender shark with a long snout. Its large mouth contains sharp, triangular teeth, typical of predatory sharks (3). The large almond-shaped eyes are located in front of pronounced spiracles: openings which enable water to be pumped through the gills whilst the shark is resting. The colour of the tope shark varies between bluish and dusky grey on top, and blends to white underneath. The tope shark possesses two dorsal fins; the second, situated over the anal fin, is much smaller than the first. Juveniles less than 61 centimetres in length have black tips on their dorsal and caudal fins and a white edge on the pectoral fins (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Mainly demersal on continental and insular shelves, but also on the upper slopes, at depths from near shore to 550 m (Ref. 6871). Has been shown to be pelagic in the open ocean (frequently caught on floating tuna longlines over deep water, and many New Zealand-tagged specimens have been recaptured in Australia) (Ref. 26346). Occurs in small schools that are highly migratory in higher latitudes in their range (Ref. 244). There is pronounced partial segregation by size and sex in some areas (Ref. 244). Feeds on fishes (bottom as well as pelagic species, Ref. 26346), crustaceans, cephalopods, worms, and echinoderms (Ref. 244). Ovoviviparous (Ref. 50449). Its meat is excellent for human consumption, liver for squalene oil, fins for soup (Ref. 244); also utilized as fishmeal (Ref. 13563). Marketed fresh, dried-salted, and frozen (Ref. 9987). Adapts well in captivity if carefully captured and handled (Ref. 12951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The tope shark Galeorhinus galeus is a slender streamlined hound shark. It can grow up to over 190 cm in length. It has a grey-brown dorsal colouring and a much paler ventral surface. The tope shark has a long and pointed snout and large oval shaped eyes. The second of the two dorsal fins is similar in size to the anal fin. Juveniles may have black markings on their fins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: tope (English), shark (English), tiburón (Espanol)
 
Galeorhinus galeus (Linnaeus, 1758)


Tope,     Tope shark


Elongate, slender body; snout long, length before mouth ~ same as mouth width; eyes horizontal ovals, with ventral nictitating membranes; mouth rounded; front nasal flaps very small;  teeth small, equal on both jaws, broadly triangular, large serrations on one side; 5 gill slits, last 2 over pectoral fin base; 2 large dorsal fins,  second distinctly smaller than first; first dorsal origin behind pectoral; anal fin same size as and second dorsal, its origin a little behind that of second dorsal; tail strongly asymmetrical, upper lobe long, upper lobe tip beyond notch = half lobe length, lower lobe very well developed.


Dark grey to grey-brown above, white below; underside of snout tip often translucent; pectorals with pale rear borders; sometimes scattered pale spots in flank.



Size: 195 cm.
        
Habitat: coastal, usually near bottom; migratory.

Depth: 0-470 m.

        Worldwide in temperate waters; British Colombia to Baja, the Revillagigedos; northern Peru Chile.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Mozambique, New Zealand Exclusive Economic Zone, Oosterschelde, Portuguese Exclusive Economic Zone, South Africa (country), Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread in temperate waters (Ref. 52183). Western Atlantic: southern Brazil to Argentina. Eastern Atlantic: Iceland to South Africa, including the Mediterranean. Western Indian Ocean: South Africa. Western Pacific: Australia and New Zealand. Eastern Pacific: Hawaii; British Columbia, Canada to southern Baja California and the Gulf of California in Mexico; Peru and Chile.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Widespread in temperate waters.

In southern Australia the species occurs from Perth in Western Australia to Morton Bay in Queensland, including Lord Howe Island (uncertain) and Tasmania. It also occurs in the Southwest Atlantic (on the shelf from southern Brazil to Patagonia) and Northeast Atlantic (including the Mediterranean where it is present but uncommon (Whitehead 1984, Notarbartolo e Bianchi 1998), eastern North Pacific (from British Columbia to southern Baja California including the Gulf of California), off Peru and Chile, and in the South Pacific, New Zealand and off South Africa (Compagno in prep b). In the Subequatorial Africa region, it ranges from Namibia to East London on the southeast coast of South Africa (Compagno in prep b). It is absent from the Northwest Atlantic and Northwest Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Temperate waters of Southern Hemisphere; North Atlantic (including Mediterranean Sea, western Baltic Sea, North Sea); North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The tope shark is widespread in temperate waters, except for the northwest Pacific and northwest Atlantic (1) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 470 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 195.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1750 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

193 cm TL (male/unsexed; (Ref. 40637)); 195 cm TL (female); max. published weight: 44.7 kg (Ref. 40637); max. reported age: 55 years (Ref. 6871)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A large houndshark with a long, pointed snout, a large mouth, and small blade-like teeth; 2nd dorsal about as large as anal fin and terminal caudal lobe as long as rest of fin (Ref. 5578). Greyish above, white below; young with black markings on fins (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Galeorhinus galeus
Catalog Number: USNM 27391
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. W. Fel Co. 'S Ex.
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. April 1883. Bulletin of the United States National Museum. No. 16: 871.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Galeorhinus galeus
Catalog Number: USNM 26973
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. April 1883. Bulletin of the United States National Museum. No. 16: 871.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Galeorhinus galeus
Catalog Number: USNM 27190
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. April 1883. Bulletin of the United States National Museum. No. 16: 871.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 51243); marine; depth range 0 - 1100 m (Ref. 26346), usually 2 - 470 m (Ref. 36731)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Most abundant in cold to warm temperate continental seas, from the surfline and very shallow water to well offshore (Compagno in prep b). In G. galeus occurs over the continental shelf from shallow, inshore bays (mainly juveniles) to about 800 m depth on the continental slope. At least in some areas (Northeast Atlantic, Tasman Sea) they also extend offshore up to 1,610 km from the coast (Fitzmaurice 1979, Brown et al. 2000). The species is primarily found near the bottom but ranges through the water column even into the pelagic zone. Similar to the Australian and South American populations, the South African population inhabits cool waters from the coastal surfline to the continental shelf (>400 m).

The life history parameters of G. galeus varies between regions. For a review of life history from different regions see Walker (1999) which draws on a number of sources including: Ripley (1946), Olsen (1954, 1959, 1984), Freer (1992), Capape and Mellinger (1988) and Peres and Vooren 1991). For a summary of life history characteristics by regional population see the tables at the end of this assessment (these will be specifically drawn upon for regional reports).

The maximum size varies considerably: the maximum size recorded is ~200 cm total length (female) in the Mediterranean (Capape and Mellinger 1998), but is somewhat smaller in the Southwest Atlantic with a maximum size of 155 cm (female); 148 cm (male) (Peres and Vooren 1991). Differences are also apparent in the size at maturity in different regions. The smallest sizes at sexual maturity are in the Southwest Atlantic where males attain sexual maturity at 107?117 cm and females at 118 to 128 cm (Peres and Vooren 1991), elsewhere the range is generally between 120 and 135 cm for males and 134 to 140 cm for females (Olsen 1954, Capape and Mellinger 1988, Peres and Vooren 1991, Freer 1992), although Ripley (1946) noted 150 cm for females and McCord (2005) reports 101 cm for males.

Reproduction is aplacental viviparity with average litters of 20 to 35 pups, with as few as six and as many as 52 observed with an average of 35 in the Eastern North Pacific (Ripley 1946, Ebert 2003)) produced in spring or early summer after a gestation period of ~12 months; the young vary in length at birth between 26 and 40 cm, depending on the region. The litter size increases in larger females. Males appear to breed every year but individual females have been reported to breed every year in the Mediterranean, every second year in Australia, and every third year in Brazil (Capape and Mellinger 1988, Peres and Vooren 1991, Olsen 1954). These may reflect real differences or may be due to the difficulties of sampling a species, which shows marked temporal and spatial sexual and size segregation, and which makes extensive movements.

These animals are very long-lived and are estimated to live for up to 60 years, although estimates vary (from around 22 years to around 40 years to up to 60 years) with region and ageing methods used. In Australia, tags have been returned from animals at liberty for more than 40 years. Age at maturity is 8 to 10 for males and 10 to 15 for females (Olsen 1954, Peres and Vooren 1991, Freer 1992, Walker 1999, Ebert 2003). The annual rate of population increase has been estimated by Cortes (2002) at 1.077 ( 95% C.I. 1.037 to 1.128) and the natural mortality by Smith et al. (1998) at 0.113.

The species feeds mainly on teleost fish, most often on bottom-associated species although pelagic fish are also taken (Walker 1999). Cephalopods, mostly squid and octopus, are also important in their diet. Small juveniles include a high proportion of crustaceans and other prey such as annelids and gastropods in their diet (Olsen 1954, Stevens and West 1997, Walker and Punt 1998). Predators (especially of juveniles) include the great white shark Carcharadon carcharias, sevengill shark Notorynchus cepedianus, and possibly marine mammals (Ripley 1946; Ebert 2001, 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6317 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2761 samples.

Environmental ranges
  Depth range (m): 0 - 1057.5
  Temperature range (°C): 5.027 - 20.525
  Nitrate (umol/L): 0.171 - 30.670
  Salinity (PPS): 33.179 - 36.097
  Oxygen (ml/l): 2.713 - 6.375
  Phosphate (umol/l): 0.133 - 2.100
  Silicate (umol/l): 0.891 - 43.248

Graphical representation

Depth range (m): 0 - 1057.5

Temperature range (°C): 5.027 - 20.525

Nitrate (umol/L): 0.171 - 30.670

Salinity (PPS): 33.179 - 36.097

Oxygen (ml/l): 2.713 - 6.375

Phosphate (umol/l): 0.133 - 2.100

Silicate (umol/l): 0.891 - 43.248
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The tope shark is a benthopelagic and demersal species inhabiting the upper continental shelf down to a depth of 550 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1100m.
Recorded at 1100 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The tope shark inhabits cold to warm temperate waters. It can be found well offshore, in shallow bays, or at the surf zone, at depths of 2 to 471 metres (4). It often occurs near the bottom, preferring substrates of sand or gravel, but can be found in mid-water or near the surface when feeding (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Surface, Mid Water, Near Bottom

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf and slope (Ref. 75154). Demersal piscivore (Ref. 12223). In the southern waters of Australia, school sharks are found in schools which are of mainly similar sex and similar size. A great part of the population migrates to the warmer waters of South Australia and New South Wales in the late summer and winter months. They return to the Bass Strait and the continental shelf around Australia during October or November (Ref. 6390). The species undertakes long migrations (movements) up to 2,500 km in the northeast Atlantic and to 1,400 km in southern Australia (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, sea-stars/cucumbers/urchins, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, without a yolk-sac placenta (Ref. 244). Embryos feed solely on yolk (Ref. 50449). 6 to 52 young in a litter (Ref. 26346). Litter size increases with the size of the mother. Embryos reach 30-36 cm TL at birth (Ref. 6080). In the southern waters of Australia, newly born and older juveniles (30-70 cm long) aggregate in 'nursery areas' found in shallow waters.They move to deeper coastal waters to over-winter. The following spring finds most of these young returning to their nursery areas. The older ones, aged 2 years and over move instead to eastern Bass Strait where most of the immature stock are found. The length of an average full-term embryo is 32 cm. Spawning frequency is once every year, ovulation occurring in early summer and parturition is completed by January of the following year. Gestation period lasts for about 12 months (Ref. 6390, 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 55 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Classification

Galeorhinus galeus (Linnaeus, 1758)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Galeorhinus galeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTGATTTTTGGTGCATGAGCAGGAATAGTTGGAACAGCTTTAAGCCTTCTAATTCGAGCCGAACTGGGACAGCCAGGATCTCTTTTAGGAGATGACCAGATTTATAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTTTTTATGGTTATACCAATCATGATTGGTGGCTTTGGAAATTGACTAGTTCCATTAATAATTGGTGCGCCTGATATAGCCTTCCCACGGATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTCCTTCTTCTCCTAGCTTCTGCCGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTATATCCTCCACTAGCAAGCAATTTAGCCCATGCTGGACCATCTGTAGATTTAGCCATTTTCTCCCTTCATTTAGCCGGTATCTCATCAATCCTAGCCTCAATTAATTTTATTACAACCATTATTAACATAAAACCCCCAGCTATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTTGTAACTACTATTCTTCTTCTCCTCTCTCTCCCAGTTCTCGCAGCAGGAATCACAATATTACTTACAGACCGTAACCTTAATACCACATTCTTTGACCCTGCAGGTGGAGGAGACCCAATCCTTTACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Galeorhinus galeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+3d+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Walker, T.I., Cavanagh, R.D., Stevens, J.D., Carlisle, A.B., Chiaramonte, G.E., Domingo, A., Ebert, D.A., Mancusi, C.M., Massa, A., McCord, M., Morey, G., Paul, L.J., Serena, F. & Vooren, C.M.

Reviewer/s
Musick, J.A., Walker, T.I., Cavanagh, R.D., Fowler, S.L., Stevens, J.D., Pollard, D. & Dudley, S. (Shark Red List Authority)

Contributor/s

Justification
A widespread mainly coastal and bottom associated shark of temperate areas which has been fished in all parts of its distribution. In the 2000 IUCN Red List, Galeorhinus galeus was listed as Vulnerable globally and Conservation Dependent in Australasia (Stevens 2000). This updated assessment retains the original Vulnerable global assessment (with updated criteria) and presents new regional assessments of this species as Critically Endangered in the Southwest Atlantic, Vulnerable in Australia and South Africa, Near Threatened in New Zealand and Least Concern in the Eastern North Pacific. Further research, monitoring and assessment of status is required for this species in the Northeast Atlantic and Mediterranean, Eastern Central Atlantic and Eastern South Pacific where it is currently considered Data Deficient. Australasia The Australia and New Zealand assessments are based mainly on two pieces of evidence: (1) In southern Australia the current mature biomass has been estimated from age-based model outputs to be below 20% of the level before commercial target fishing began in the 1920s, and; (2) Very low biological productivity; maximum age is potentially 60 years, age at maturity in females exceeds 10 years. In New Zealand, the stock has been managed for 17 years, and landings have been stable for the past decade. However, commercial TACs introduced following some CPUE declines have been regularly exceeded. Fisheries for the species are managed by ITQs in both New Zealand and Australia that should allow stocks to begin to rebuild, but the sustainable catch level in New Zealand remains unknown. Southwest Atlantic In the Southwest Atlantic the G. galeus population is subject to intensive fishing throughout its distribution, drastic declines have occurred yet the population continues to be fished without restraint. The declines have been most marked in Brazil and Uruguay, where the CPUE has declined almost to zero. The species migrates seasonally between wintering grounds in south Brazil and Uruguay and summer grounds off Argentina where the pupping and nursery areas are situated and where intense and directed fishery of gravid females occurs. In Argentina, where the animals are generally smaller, the CPUE for the trawler fleet has declined by around 80% during the past decade and based on current trends will inevitably collapse within 5 to 10 years. Already considered Critically Endangered, without major and urgent management measures the situation for this species in the Southwest Atlantic is set to become even worse. South Africa In South Africa Galeorhinus galeus has been targeted to varying degrees since the 1930s and likely prior to that by indigenous coastal communities. As the principal target species of the directed South African shark fishery it is likely that the population has been affected. There is evidence of declines from commercial catch data and observations from shark longline fishermen. Also of concern is data from the Gansbaai longline fishery showing a high proportion of the catch to be immature females. Recent estimates based on a spawner biomass per recuit model (therefore must be considered with caution) suggest that biomass of the South Africa population is at 43% of pre-exploitation level (M. McCord 2005). It is possible that the South African population is currently being fully exploited and any increase in fishing pressure may result in a decline of biomass to below 40% of the unexploited level (McCord 2005). The lack of well-designed regulations governing the South African recreational and commercial shark fisheries and lack of bag limits/bycatch limits in other fisheries that take G. galeus means that a hypothetically unlimited fishery exists for that species. Given the life-history characteristics of this species (long generation time, late age at maturity, first age of reproduction) and the knowledge of the state of the fisheries for these sharks elsewhere it is likely that the South African population of G. galeus is highly susceptible to overfishing and the Vulnerable assessment is based on the fact that the current shark fishery is virtually unregulated, declines have apparently already taken place and are predicted for the future. Proposed policy for 2005 indicates that long-term rights for the shark fishery will be allocated and multi-species permits will be revoked and replaced with single-species permits. It is envisaged that demersal longline permits to target soupfin sharks will be restricted in number as will the number of traditional handline vessels permitted to catch traditional linefish (including sharks). This will alter the characteristics of the fishery and it is highly recommended that another stock assessment be completed within 3 to 5 years to evaluate the effect of these changes on the population. As for its range into Namibia and southern Angola; there is no fishery for this species, they may be occasionally caught in trawl fisheries but there is no further information at this time. Northeast Atlantic Galeorhinus galeus is of limited importance in commercial fisheries in the Northeast Atlantic where it is typically a bycatch of mixed demersal and pelagic fisheries especially by French vessels fishing in the English Channel, Western Approaches and northern Bay of Biscay. In Europe, this species is important in recreational fisheries. Data is apparently limited, as landings are often included as "dogfishes and hounds". Nevertheless, England and France have species-specific landings data and there are also limited data from Denmark and Ireland in recent years. Tope also feature in catch statistics for Portugal and the Azores. Biological data for Northeast Atlantic stocks are limited. Due to lack of data to form the basis of an accurate assessment, the species is considered Data Deficient in the Northeast Atlantic at this time and further investigation into its status there is required. Mediterranean Although there are no target fisheries for G. galeus in the Mediterranean, declines are suspected to have occurred, and it is only rarely seen as bycatch. Overfishing, together with habitat degradation caused by intensive bottom trawling are considered the main factors that have produced the suspected decline of the Mediterranean stock. Due to lack of data to form the basis of an accurate assessment, the species is considered Data Deficient in the Mediterranean. Eastern North Pacific Galeorhinus galeus was the mainstay of the shark fishery ?boom? between 1936 and 1944, when over 24 million pounds were landed. The fishery ended abruptly in 1946 with the development of synthetic vitamin A. Since 1977, the fishery has averaged between 150,000 and 250,000 pounds dressed weight landed annually. Since no studies on this species have taken place in over 50 years in this region, it is unknown whether stocks off California have attained the size of those exploited before the second world war. However while it appeared that the adult stock might have collapsed at that time, there would have been large stocks of juveniles to allow for a population recovery. Since the 1940s there has been no economic incentive to target it and these sharks are now mostly taken at low levels as a bycatch to other commercial species and by recreational anglers. Although there has been no stock assessment for several decades, the fishing mortality can be expected to be low, landings have been relatively stable and given the lack of a concentrated fishery at this time this species is listed as Least Concern for the eastern North Pacific. However, if fishing pressure increases it will be necessary to re-evaluate this assessment. Eastern Central Atlantic and Eastern Pacific (off Peru and Chile) There is currently no information from the Eastern Central Atlantic off West Africa, nor in the Eastern Pacific off Peru and Chile. However, given the evidence of decline and low recovery capacity from other parts of its range, it is imperative that the status of this species is further investigated in these and other regions for which this species is considered Data Deficient, in order to establish appropriate conservation and management measures.

History
  • 2000
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Vulnerable

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species makes extensive migrations, for example, animals tagged in the United Kingdom showing mixing throughout their Northeast Atlantic distribution and being recaptured as far away as to the north of Iceland (2,461 km), the Canary Islands (2,526 km) and the Azores (1,610 km off the coast of Portugal) (Fitzmaurice 1979, Holden and Horrod 1979, Stevens 1990). In Australia, tagging has shown mixing across most of the southern half of the continent (with movements of up to 1,260 km) and a number of animals have moved across the Tasman Sea between Australia and New Zealand (Olsen 1984, Brown et al. 2000).

Spatial and temporal variations in size structure and sex ratio are apparent for various populations of G. galeus (see Walker 1999), which have implications for management. The species appears to have fairly discrete pupping and nursery areas, which are often in shallow, protected bays and estuaries (Olsen 1954).

Australasia
Inshore waters of Victoria and Tasmania include nursery areas for this species. Olsen (1959,1984) reported a decline in abundance of juveniles in two Tasmanian nursery areas sampled regularly over a five-year period. He attributed this decline to fishing pressure on pregnant females during their pupping migration and to intensified fishing of juveniles in inshore areas such as Port Phillip Bay during the period 1940 to 50. In Port Phillip Bay during 1943 to 1945, 60,000 juveniles averaging 0.9 kg in weight were caught annually. A continuation of this nursery area sampling during the 1990s (Stevens and West 1997) indicated a substantial further reduction in abundance of school shark pups and small juveniles in Tasmanian and Victorian embayments and estuaries. Since the abundance of pups sampled in these areas seems insufficient to account for the current adult stock size it is likely that other pupping areas exist, either outside Victoria and Tasmania, or more likely, close inshore along ocean beach coastlines. In New Zealand inshore embayments such as Kaipara Harbour are nursery areas for this species (Walker 1999).

Southwest Atlantic
The southwest Atlantic population of G. galeus migrates seasonally between wintering grounds off south Brazil and Uruguay, and summer grounds off Argentina where the pupping and nursery areas are situated.

In the wintering area off south Brazil the species occurs from April to November, south of latitude 33°S over smooth bottom at depths of 40 to 330 m (Vooren 1997). Only large juveniles (mostly with TL from about 70 cm onwards) and adults of both sexes migrate in winter to south Brazil, where at that time the gravid females concentrate during the final phase of gestation and where the non-gravid adult females copulate in a specific area on the upper continental slope (Peres and Vooren 1991, Ferreira and Vooren 1991). Birth does not occur in south Brazil.

In Argentina the commercial fishery operates inshore at depths of 18 to 57 m, from September to December off Buenos Aires Province, then in January and February in northern Patagonia, then in March-April again off Buenos Aires (Chiaramonte 1998, Elías et al. 2004). These periods correspond with the months of departure and arrival of the species in south Brazil. It is inferred that the age groups older than about five years of the population as a whole migrate between Argentina and south Brazil, and that the nursery grounds are situated in Argentine waters and in some cases are where critical habitat is known to have been lost (e.g., Bahía Blanca and El Rincón).

South Africa
Little is known about the movements of the South African population of G. galeus (Freer 1992). Seasonal differences exist in catch composition, females comprise the majority of the catch (~90%) from December to January and males comprise close to 100% of the catch between April and September (Freer 1992, M. Kroese pers. comm. 2003). Catch records from the RV Sardinops and RV Africana indicate that midsummer (December) catches are dominated by pregnant females (Freer 1992). Individuals have been caught up to depths exceeding 400 m, although they are most frequently caught between 55 to 150 m (McCord 2005). It is thought that female G. galeus give birth in lagoons and estuaries along the west coast of South Africa (Compagno et al. 1989), and although no nursery areas have been conclusively identified, Freer (1992) suggests shallow embayments such as Struis, St.Helena, Walker and False Bays, and data from the Gansbaai longline fishery with a high proportion of the catch being immature females may also be a nursery area for this species (M. McCord pers. comm).

Northeast Atlantic
Little is known regarding critical habitats but nursery areas may occur off Portugal and around the Canary Islands (Munoz-Chapuli 1984), and possibly in the Bristol Channel, UK (see Walker 1999 for further details).

Eastern North Pacific
In the eastern North Pacific, young and immature sharks are caught off Ventura Flats, San Francisco Bay, Monterey and Tomales Bay. Southern California below Point Conception (especially Ventura Flats, east of Santa Barbara) is an important G. galeus nursery ground, with considerable numbers of adult females and newborns being found there in the spring. They are known to segregate by sex and size. South of Point Conception, adult males tend to be found further offshore in deeper water (>20 m), while females are in usually found in shallower water (<15 m). The proportion of large mature males is highest in northern California, while mature females are most abundant in southern California. North of Point Conception there is a greater proportion of smaller immature females, but in central California the sex ratio is about even (Ripley 1946, Ebert 2001, 2003). They are highly migratory, moving north during the summer and south during the winter or into deeper waters. They are swift moving and can travel up to 34 miles per day and have been reported to travel at a sustained rate of 10 miles per day for up to 100 days. One shark tagged off Ventura in southern California was captured 26 months later off Vancouver Island, British Columbia. Another shark was tagged in San Francisco Bay and recaptured 12 months later in the same location.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2bd+3d+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
G. galeus has a long history of exploitation in target fisheries in most parts of its range where the species has been in demand for liver-oil, meat and fins. The main threat to the various populations of G. galeus is from targeting widely with gillnets and longlines. Minor threats include fishing with trawls and other methods. There is accidental capture of pups on nursery grounds in gillnets of small mesh-size and recreational fishers operating in inshore shallow-water areas. Habitat degradation in potential nursery areas due to development and siltation may also negatively affect recruitment to populations of this species. Other threats are habitat degradation by the effects of trawling through disturbance of substrates (Walker 1998) and installation of high voltage direct current sub-sea cables with induced magnetic and electric fields across their migration lanes (Walker 2001).

Australasia
In south-eastern Australia, the harvest of G. galeus began in the mid-1920s, but increased markedly during the war years with the market for shark liver oil. Catches levelled off at about 2,000 t live weight during 1949 to 1957 with the decline of the liver market and as the fishery spread from inshore to offshore waters (Olsen 1959). Establishment of the shark meat market and the introduction of gillnets in 1964, production rose rapidly to peak during 1969 at 3,158 t. Following a ban on the sale of large school sharks in 1972 because of high mercury levels, catches declined for about 10 years. With relaxation of the mercury laws catches again increased, reaching 3,060 t during 1986. Since 1986, the total annual catch from the Southern Shark Fishery had declined to 172 t by 2001 (Walker 1999, Walker et al. 2002). The mature biomass has been estimated from age-based model outputs to be below 20% of the level before commercial target fishing began (Punt et al. 2000).

In New Zealand, G. galeus have been exploited since the mid-1940s. With the demise of the liver oil fishery in the 1950s, a market for the meat developed (some is exported to Australia) and catches peaked at 5,000 t live weight in 1984 (Francis 1998, Paul and Sanders 2001). Catch levels have been ~3,000 t for the past decade, but it is not known if this, or the current commercial TACs (3,107 t), are sustainable, or if they are at levels that will allow the stocks to move towards a size that will support the maximum sustainable yield.

Southwest Atlantic
In this region mean annual individual fecundity is only seven pups, age at first breeding is about 13 years in both sexes, and natural mortality rate is low as evidenced from the longevity of 40 years (Peres and Vooren 1991, Ferreira and Vooren 1991). These parameter values characterize the species as susceptible to recuitment overfishing. In Uruguay the species was fished intensively in the 1940s for liver oil. The southwestern Atlantic population of the species has been subject to intensive fishing in its entire area of distribution since about 1985. Statistics of the fishery CPUE in south Brazil and Uruguay are evidence that as a result of intensive fishing from 1985 the abundance of the species had decreased by 85% in 1997, and the fishery in this region continues without restraint (Miranda and Vooren 2003). Since 1995 the species has disappeared in the coastal fishery off Uruguay (A. Domingo unpublished data). The species migrates seasonally between wintering grounds in south Brazil and Uruguay and summer grounds off Argentina where the pupping and nursery areas are situated, where intense and directed fishery of gravid females occurs and where critical habitat is known to have been lost (e.g., Bahía Blanca and El Rincón). Yields in Argentina dropped sharply after intensive fishing and high landings in the years 1988 to 1992 (Chiaramonte 1998). Since then declines have continued. The declared landings for ?sharks+cazón? in the SAGyP statistics (the national authority for fisheries in Argentina), and in which G. galeus comprises most of these landings, show overall declines of over 80% between 1992 (4,012 t) and 2004 (757 t), with landings around 1,000t or less since 2000, yet in the mid-1980s the landings were >5,000 t. These declines are attributed to recruitment overfishing and if the fishery continues, the population will very likely be extirpated. Despite this, in the late 1990s new access to the fishery was granted to a large number of artisanal fishermen (at present around 700 are registered in Buenos Aires province), and no management is in place.

South Africa
In South Africa Galeorhinus galeus is targeted (mainly when catches from other non-elasmobranch fisheries are low) in longline and handline fisheries and taken incidentally in artisanal and recreational fisheries. In 2003, 23 permits were issued to shark fishermen, however no seasonal/temporal restrictions have been placed on the fishery nor on number or size of G. galeus landed. Kroese and Sauer (1998) determined that the landed catch of soupfin shark between 1992 and 1994 reached a peak of 48 t (1994, dressed carcass weight) and a minimum of 5.2 t in 1993. Anecdotal evidence suggests that CPUE of soupfin sharks has declined in the last 15 years (G. Kingma, soupfin shark longline fishermen, Hout Bay, Western Province, pers. comm. February, 2003) and data from the South African Shark Management Plan (MCM 2002) indicates that the annual commercial linefish catch of soupfin shark has significantly declined, from a peak of 249 t in 1992 to 71 t in 1999. It is unclear whether this is due to a change in target species, change in effort, or change in the population size. According to Freer (1992), 41.6% of total catch by mass in the Gansbaai longline fishery is female, 87.4% of which are immature females. This indicates that a relatively high number of immature females are being extracted from the population, thereby possibly influencing future recruitment (Freer 1992). Similar to other populations of soupfin shark, those in South Africa segregate according to sex and size. This combined with life-history parameters make these sharks vulnerable to over-exploitation. There are indications that the South African population is currently being fully exploited and any increase in fishing pressure may result in a decline of biomass to below 40% of the pre-exploitation condition (McCord 2005).

Northeast Atlantic
Tope is of limited commercial importance in commercial fisheries in the Northeast Atlantic where it is typically a bycatch of mixed demersal and pelagic fisheries, especially French vessels fishing in the English Channel, Western Approaches and northern Bay of Biscay. Data is apparently limited, as landings data are often included as "dogfishes and hounds". Nevertheless, England and France have species-specific landings data and there are limited data from Denmark and Ireland in recent years (ICES 2004). France appears to target tope, and reported landings of approximately 350 to 500 t/year during the 1990s (landings were higher in 1987 at 600 t, some 6% of the total shark catches, with tope ranking third behind spurdog and lesser spotted dogfish). Tope also feature in catch statistics for Portugal Mainland and in the Azores. In the Azores this species is a bycatch of the demersal longline fishery. Biological data for Northeast Atlantic stocks are limited (SGRST 2002).

Tope is important in recreational fisheries with some anglers specializing in tope catching. Recently, a newspaper article (Fishing News, June 17th 2005) urged English North Sea fishermen to target tope for meat and for the fin trade out of Lowestoft, East Anglia. This has raised cause for concern, including among the recreational fishers (see www.sharktrust.org for further details). The value of this species for recreational angling on the south coast of England (and presumably elsewhere off the UK) is high.

Mediterranean
Although no direct fisheries for G. galeus exist in the Mediterranean, it was traditionally caught as bycatch in gillnets and trammel nets in the Northern Adriatic Sea, also as bycatch of semi-industrial (Adriatic Sea and Sicily) and artisanal fisheries in pelagic and demersal nets, deep longlines, drift lines and troll lines (Fisher et al. 1987). A small directed gillnet fishery targeting Mustelus spp. and Squalus spp. operated off the Balearic Islands in the past which reported catches of G. galeus. In recent times, only bottom trawl and longline fisheries have reported continuous bycatch of G. galeus, and such reports are very rare nowadays. The development of the bottom trawl fisheries in the Mediterranean over the first half of the 20th century in the northern range, and during the latter half in the southern range, is considered as one of the principal factors responsible of the decline of many demersal elasmobranch species. In this sense, both overfishing and habitat degradation must be considered as factors potentially responsible for declines. The analysis of the Medits trawl survey data from 1994?1999 shows a very low frequency of occurrence for G. galeus in the Mediterranean (only five positive hauls or 0.05 %), although it should be noted that trawling is a minor threat to this species and numbers in trawl surveys would not be expected to be high. Its overall biomass was estimated to be 0.2 kg/km² for the Mediterranean. The standing stock biomass was estimated at 126 t (0.23%) (Baino et al. 2001). Off Italy, Relini et al. (2000) reported the capture of G. galeus in only one of the 11 zones studied as part of the Italian national project (9,281 hauls in total, around the Italian coast, from 1985?1998), although data on biomass for this species were not provided. Tuna trap data from the Northern Tyrrhenian Sea from 1898 to 1992 shows a dramatic decrease in the abundance of G. galeus catches (80 individuals between 1898 and 1905; only eight for the 1906 to 1913 period and 0 from 1914 to 1922) (Vacchi et al. 2002). Thus, these data can perhaps be interpreted as an indication of early depletion of the population at least in shallow waters in this area, which could also have occurred in other Mediterranean areas where similar practices historically operated. Data from the Medits survey for the Adriatic Sea were compared with those from the survey Hvar, carried out in 1948 (Jukic-Peladic 2001). Although no data on individual species captured biomass are reported, G. galeus appeared in the 1948 survey, but not in the Medits survey. Data on elasmobranch landings from the long-line fleet at the Palma de Mallorca (Balearic Islands) central fish auction wharf reported only one specimen in 1996 (B. Reviriego pers.comm.), six in 1999 (G. Morey pers.comm.) and recent regular visits have reported no further specimens. In addition, G. galeus was not specifically reported in the official landing statistics, since it did not appear in the 1999 to 2001 period, thus furthering the difficulties in monitoring of the population. For the Spanish long-line fleet off the Levantine coast, operating mainly in the Alboran Sea and around the Balearic Islands, the observed catch rate (as bycatch) of G. galeus is about five specimens per ship and year (D. Macías pers.comm.) In Tunisian waters, where there exists a lower fishing pressure than off the northern Mediterranean coasts, the species is considered to be very rare (Bradai 2000).

Eastern North Pacific
In the Northeast Pacific the shark fishery off California rapidly expanded during the 1930s due to the demand for liver-oil. Catches increased, peaking at 4,185 t in 1939 with around 75 to 80% of the catch being G. galeus and prices for the liver-oil rose from some US$50/t in 1937 to US$2,000/t in 1941 (Ripley 1946). While the fishery was intensive and expanded rapidly it only lasted eight years, during which CPUE was reported to decline dramatically. Although the fishery collapsed in the 1940s (due primarily to the synthetic production of Vitamin A) it seems unlikely that the stock itself collapsed. Only the large animals were being targeted, with 10-inch mesh size, fishermen were not interested in catching the young animals, which had lower grade Vitamin A in the liver oil. Therefore while it appeared that the adult stock might have collapsed there would have been large stocks of juveniles to allow for a population recovery. Since the 1940s given the low price for soupfin shark and low interest in the meat there has been no economic incentive to target it, and it is now caught at low levels as bycatch with bottom and pelagic gillnets, bottom and pelagic longlines, bottom and pelagic trawls, and with hook-and-line. (Ripley 1946, Ebert 2003, Compagno in prep b). Thus although there has been no stock assessment for over 50 years, the fishing mortality can be expected to be low. Cailliet et al. (1992) reported the fishery over the past several decades had remained fairly steady, even declining due to increasing fishing restrictions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tope sharks have been exploited for many years in most parts of its range where its flesh is consumed by humans, its fins are used in shark fin soup, large quantities of vitamin A can be extracted from the oil in the liver, and the skin is made into leather products (1) (4). Large scale commercial fisheries targeting tope continue in many regions, including Uruguay, Argentina, California, southern Australia, and South Africa. Its life-history and biology make this species particularly vulnerable to overexploitation and fisheries for Tope in both California and Australia have collapsed. Currently, the Australian population has recovered and the fishery remains well-managed (9). Tope is also a common and popular catch of sports anglers (4). Tope sharks may also be threatened by the degradation of inshore nursery areas, as these habitats are particularly vulnerable to human activities (1). The installation of high-voltage cables under the sea bed can induce magnetic and electrical fields across their migration lanes (1), potentially disrupting their migration, and feeding and reproductive biology (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Outside Australia and New Zealand there are no, or few, regulations established for populations of G.galeus, see Walker (1999) for a fairly recent review. However, there is increasing international recognition of the threats facing this species. At the CITES Conference of the Parties (CoP) 13 held in 2004, the CITES Animals Committee had a specific recommendation regarding G. galeus. The following text is taken from CoP13 Doc. 35, Annex 2 (CITES): G. galeus are valued for their meat and fins and are (or have been) important in target and multispecies fisheries in temperate waters world-wide. Most stocks are shared between several range States, and in most regions are seriously depleted. Only a small number of States have achieved successful management of this biologically-vulnerable species. The Animals Committee recommends that range States request FAO's assistance with developing a capacity building workshop for this species in order to train managers from developing States and other States where coastal shark fisheries are not being managed. This would also serve as a case study for the management of other coastal shark fisheries.

In addition, CITES CoP13, Decision 13.42 directed to Parties states that Parties "should take note of the species-specific recommendations in document CoP13 Doc. 35 Annex 2 with a view to ensuring that international trade is not detrimental to the status of these species." This includes G. galeus.

See Walker (1999) for a fairly recent and thorough review of relevant management measures, some updates are provided below:

Australasia
Management measures in the fishery of southern Australia where the stock is most depleted include limited entry for the use of gillnets and longlines (since 1984) and, for all fishing sectors, TAC (since 2000). Input controls include limits on length of net (since 1988), various 4 to 6 week closed seasons to protect pregnant animals of G. galeus during October to December (1953 to 1967 and 1993 to 1994), and a legal minimum mesh-size of six inches for gillnets (since 1975) for most of the fished area. Closed areas to commercial gillnetting in inshore waters of Tasmania have been variously implemented since 1954 to protect newborn, juvenile and pregnant G. galeus on nursery areas. A more extensive closed area was adopted during 1988 when all Victoria proclaimed waters (inside three-mile limit) were closed to the use of shark gillnets and longlines. Legal minimum lengths were phased in by the States and Commonwealth during 1949 and the early 1950s and remain current. During 2002, the TAC for G. galeus was 269 t for the Southern Shark Fishery, 33 t for the South East Trawl Fishery, and 2 t for the Great Australia Bight Trawl Fishery.

In New Zealand, minimum mesh-sizes of 125 mm and 150 mm apply for G. galeus in northern New Zealand and southern New Zealand, respectively. Numerous general restrictions apply to the use of commercial and recreational gillnets and longlines, including limits on the length of gillnets, number of hooks per longline, number of longlines, soak time, the amount of an estuary or bay that can be blocked by a gillnet, and areas that can be fished. The restrictions vary regionally and are designed to reduce the number of nets lost and the amount of fish wasted to sea lice and decay because of excessively long sets, and to minimise conflict with other users of inshore waters. Also, G. galeus is covered by the mixed species daily bag limits for recreational fishers of 20 and 30 fish for the northern and central regions and southern region of New Zealand, respectively. In October 1986, the commercial TAC was set at 2,590 t, but this had increased to 3,107 t by 1995 to 1996 (as a consequence of quota appeals, not stock assessment) and was current in 2003. The commercial TAC was exceeded by up to 10% in the late 1990s.

Southwest Atlantic
In the El Rincon area of Argentina where gravid females occur, a restriction has been established for the fishing fleet during the months in which these sharks approach the shore (A. Massa pers. comm). No other conservation or management measures are in place for this species. A ban on fishing G. galeus is recommended at the regional level involving Argentina, Uruguay and Brazil.

South Africa
There are no conservation measures in place at present. Proposed policy for 2005 indicates that long-term rights for the elasmobranch fishery will be allocated and multi-species permits will be revoked and replaced with single-species permits. It is envisaged that only six demersal longline permits will be issued to target soupfin sharks. The number of traditional handline vessels permitted to catch traditional linefish (including sharks) will also be restricted in terms of numbers. This will alter the characteristics of the fishery and it is highly recommended that another stock assessment be completed within 3?5 years to evaluate the effect of the aforementioned changes on the population. McCord (2005) made several management recommendations for the period 2005?2010 including restrictive licensing, size restrictions and seasonal/area closures.

Eastern North Pacific
There are no conservation measures in place currently other than in California, gillnets are prohibited in State waters, although gear regulations do not apply specifically to G.galeus here or in other areas of its Eastern North Pacific range. The status of the population is unknown, and this species hasn?t been intensively studied for over 50 years. The situation needs to be studied in detail in terms of stock assessment and biological parameters (e.g., age and growth has never been studied for the species in this region), and this assessment revisited when more information is available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There are several measures in place in Australia and New Zealand to regulate tope fisheries, such as limits on the fishing gear used, closed seasons for nursery areas, and limits on the number that recreational fishermen can catch (1) (5). South Africa also has a limit on recreational catches (5), but otherwise, there are few regulations to protect this vulnerable species (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; aquarium: public aquariums; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

School shark

Common names: school shark,[1] tope shark,[2] soupfin shark,[3] snapper shark.[1]

Galeorhinus galeus is a hound shark of the family Triakidae, the only member of the genus Galeorhinus, found worldwide in subtropical seas at depths of up to 550 metres (1,800 ft). It grows to 2 metres (6 ft 7 in) long. Reproduction is ovoviviparous.

Contents

Appearance

School sharks are dark bluish gray on the back (dorsal) side, and white on their bellies (ventral side). Mature sharks range from 135-175 cm for males, and 150-195 cm for females.[4]

Uses

Cazón en adobo

The meat of the school shark is consumed in Spanish cuisine where it is usually known as cazón. Among recipes are the traditional cazón en adobo in the mainland, and tollos in the Canary Islands. In Mexican cuisine, the term cazón refers to other species, and is prepared similarly.

Conservation status

In 2010, Greenpeace International added the school shark to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[5]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!