Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Comprehensive Description

Biology

Inhabits silty, sandy, and rocky pools and runs, sometimes riffles, of creeks and small to medium rivers. Tolerates siltation and high turbidity (Ref. 5723). Feeds on terrestrial and aquatic insects, and algae (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Absent

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range includes the Mississippi River basin from Wyoming, South Dakota, southern Wisconsin, and Indiana south to Louisiana (but absent in Ozark and Ouachita uplands); Gulf drainages west of the Mississippi River to the Rio Grande, Texas, New Mexico, and Colorado, and the Rio Panuco in northeastern Mexico (Page and Burr 2011). This species has been widely introduced in the Colorado River basin, in North Carolina, and elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range includes the Mississippi River basin from Wyoming, South Dakota, southern Wisconsin, and Indiana south to Louisiana (but absent in Ozark and Ouachita uplands); Gulf drainages west of the Mississippi River to the Rio Grande, Texas, New Mexico, and Colorado, and the Rio Panuco in northeastern Mexico (Page and Burr 2011). This species has been widely introduced in the Colorado River basin, in North Carolina, and elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Mississippi River basin from southern Wisconsin and eastern Indiana to South Dakota and Wyoming and south to Louisiana, USA; Gulf drainages west of Mississippi River to Rio Grande in Texas, New Mexico and Colorado, USA. Widely introduced elsewhere in USA. Also in northern Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S.A. to northern Mexico; widely introduced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 7 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 90 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 3 years (Ref. 3672)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Cyprinella forbesi
Catalog Number: USNM 29869
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): S. Forbes
Year Collected: 1880
Locality: Illinois, Illinois R., Illinois, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343722
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343599
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343598
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343597
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343596
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343595
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343594
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343593
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343592
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343591
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande River, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 343590
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande River, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Lectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 16976
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande River, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Lectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 16980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Hypsilepis iris Gilbert
Catalog Number: USNM 16977
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Cope & H. Yarrow
Year Collected: 1874
Locality: Pools of Rio Grande, San Ildefonso, N.M., New Mexico, United States, North America
  • Syntype: Cope, E. D. 1875. Geological and Geographical Exploration and Survey West of the 100th Meridian. 5 (Chapter 6): 653, pl. 31.; Paralectotype: Gilbert, C. R. 4 February 1998. Special Publication, Florida Museum of Natural History. No. 1: 96.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes perennial creeks and small to medium rivers, canals, lakes, ponds, and ephemeral habitats with high turbidity and few competing species; silty, sandy, and rocky pools and runs, sometimes riffles (Sublette et al. 1990, Page and Burr 2011). This species often is the most abundant minnow in a wide variety of low gradient habitats, especially backwaters, creek mouths, and medium-sized streams with sand/silt bottoms. It is uncommon or absent in clear high-gradient streams. It selects water with negligible (or intermittent) flow deeper than 20 cm, and it avoids temperature extremes in summer and winter, but does well in harsh and variable environments when other species disappear (Mayden 1989). Spawning occurs in quiet waters of lakes or streams, often over sunfish nests, clean gravel or sand of riffles, submerged roots or logs, or aquatic plants, or on rocky shorelines in crevices. Eggs sink and adhere to bottom (gravel, sand, or mud). Male defends spawning territory.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes perennial creeks and small to medium rivers, canals, lakes, ponds, and ephemeral habitats with high turbidity and few competing species; silty, sandy, and rocky pools and runs, sometimes riffles (Sublette et al. 1990, Page and Burr 2011). This species often is the most abundant minnow in a wide variety of low gradient habitats, especially backwaters, creek mouths, and medium-sized streams with sand/silt bottoms. It is uncommon or absent in clear high-gradient streams. It selects water with negligible (or intermittent) flow deeper than 20 cm, and it avoids temperature extremes in summer and winter, but does well in harsh and variable environments when other species disappear (Mayden 1989). Spawning occurs in quiet waters of lakes or streams, often over sunfish nests, clean gravel or sand of riffles, submerged roots or logs, or aquatic plants, or on rocky shorelines in crevices. Eggs sink and adhere to bottom (gravel, sand, or mud). Male defends spawning territory.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 7.0 - 7.5; dH range: 10 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 3 taxa.

Environmental ranges
  Depth range (m): 0.5 - 0.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats various small invertebrates (insects, crustaceans), plant material (digestibility may be low), and microorganisms (Becker 1983). In Virgin River, diet dominated by Ceratopongidae, Simuliidae, and Chironomidae (Greger and Deacon 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits silty, sandy, and rocky pools and runs, sometimes riffles, of creeks and small to medium rivers. Tolerates siltation and high turbidity (Ref. 5723). Feeds on terrestrial and aquatic insects, and algae (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large (greater than 1 million).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in spring and summer; probably June-August in Wisconsin, May-August in Illinois, May-October with June-July peak in Kansas and Missouri, April-September in Texas and Oklahoma. One-year-olds spawn in late summer after two-year-olds. Eggs hatch in ca. 105 hours at 24.5 C. May produce several clutches each year. Sexually mature in 1-2 yr.; most breed in second summer, very few in first summer (Mayden 1989). Reproduction by young-of-the-year likely facilitates attainment of numerical dominance in many sites where this species has become established (Marsh-Matthews et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyprinella lutrensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTCTTTTCTACAAATCACAAAGATATTGGTACCCTTTATTTAGTATTTGGTGCCTGAGCTGGAATAGTAGGAACCGCTTTAAGCCTCCTTATTCGAGCCGAATTGAGTCAACCTGGCTCACTTCTAGGCGAT---GATCAAATCTATAATGTAATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTCTTATCGGGGGGTTCGGGAACTGGCTTGTACCTCTAATGATCGGGGCACCCGATATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTTCTACCCCCATCATTCCTCTTATTACTAGCTTCCTCTGGTGTTGAAGCTGGTGCCGGAACTGGATGAACTGTATACCCCCCACTTGCAGGTAATCTCGCCCACGCAGGAGCATCAGTAGATCTCACGATCTTCTCTCTACATCTAGCAGGTGTATCCTCAATTCTAGGGGCAGTTAACTTCATTACTACAATTATTAACATAAAACCCCCAGCAATCTCTCAGTATCAGACACCTTTGTTTGTATGAGCCGTACTTGTAACCGCCGTACTTCTGCTCCTATCACTACCTGTGTTAGCTGCCGGAATTACTATACTTCTTACAGATCGTAACCTCAACACCACATTCTTTGACCCAGCAGGAGGGGGTGATCCTATTTTATACCAACACTTATTTTGATTCTTCGGTCACCCCGAGGTTTACATTCTTATTTTACCAGGGTTTGGAATCATTTCACACGTTGTAGCCTATTACGCAGGTAAAAAAGAGCCATTTGGCTACATAGGGATAGTTTGAGCCATGATGGCCATCGGCCTCCTAGGCTTTATTGTCTGAGCCCATCACATGTTTACTGTCGGAATGGATGTAGACACCCGCGCCTACTTTACATCTGCAACAATAATTATTGCCATTCCAACTGGTGTAAAAGTATTTAGCTGACTTGCCACGCTCCACGGAGGC---TCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyprinella lutrensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NX - Presumed Extirpated

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: TX - Presumed Extinct

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Global Long Term Trend: Increase of 10 to >25%

Comments: Where introduced, this species may "swamp-out" native Cyprinella gene pools through hybridization (see Mayden 1989). This species has increased in abundance in the lower Missouri River as a result of human-caused changes in the river (e.g., reservoir construction) (Pflieger and Grace 1987). Introduced populations may be detrimentally impacting native spikedace population in the Gila River system (Douglas et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but very large (greater than 1 million).

Where introduced, this species may "swamp-out" native Cyprinella gene pools through hybridization (see Mayden 1989). This species has increased in abundance in the lower Missouri River as a result of human-caused changes in the river (e.g., reservoir construction) (Pflieger and Grace 1987). Introduced populations may be detrimentally impacting native spikedace population in the Gila River system (Douglas et al. 1994).

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: No major threats are known.

Subspecies blairi from Maravillas Creek drainage in the Big Bend region of Texas apparently is extinct, possibly through the effects of introduced Fundulus zebrinus (Miller et al. 1989, Matthews 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known.

Subspecies blairi from Maravillas Creek drainage in the Big Bend region of Texas apparently is extinct, possibly through the effects of introduced Fundulus zebrinus (Miller et al. 1989, Matthews 1987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Eradication of this species from the Virgin River system, Utah, is needed to ensure long-term survival of native fishes (USFWS, Federal Register, 13 August 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action. Due to negative impacts on native species, red shiners need to be eradicated in some areas where they have been introduced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Widely used as a baitfish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Implicated in the decline of the endangered woundfin and Virgin River chub and the special concern Virgin spinedace (USFWS, Federal Register, 13 August 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red shiner

The red shiner (Cyprinella lutrensis) is a North American species of freshwater fish in the Cyprinidae family. They are deep-bodied and laterally compressed,[1] and can grow to about three inches in length. For most of the year, both males and females have silver sides and whitish abdomens. Males in breeding coloration, though, have iridescent pink-purple-blue sides and a red crown and fins (except the dorsal fin which remains dark).[2]

Red shiners can live up to three years. They are omnivorous; they eat both aquatic and terrestrial invertebrates, as well as algae.[3] Red shiners have also been known to eat the eggs and larvae of native fish found in locations where they have been introduced.[4]

Reproduction[edit]

The spawning season for red shiners is generally from mid-April through September.[1] In addition to spawning in crevices like other members of the genus Cyprinella, red shiners also broadcast their eggs and attach them to rocks and vegetation.[5] Females can release up to 16 batches per day with up to 71 eggs per batch. The average clutch size, however, is 585 eggs and they may have five to 19 clutches in one reproductive season.[6] Red shiners are capable of generating viable hybrid offspring with closely related species, such as the blue shiner and the blacktail shiner.[5]

Habitat[edit]

Red shiners are found naturally in a variety of aquatic habitats, including backwaters, creek mouths, streams containing sand and silt substrates, riffles, and pools.[1] [7] They are tolerant of areas of frequent high turbidity and siltation,[8] but they tend to avoid waters with high acidity.[9] Red shiner are habitat generalists in that they are adapted to favor a wide range of environmental conditions that most other fish species cannot tolerate. These include habitats degraded by human disturbance, and those with poor water quality (such as polluted waterways), natural physiochemical extremes, and seasonally intermittent flows.[5]

Range[edit]

Map of the native and non-native distribution of red shiners (Cyprinella lutrensis) in the United States

The red shiner is naturally found in the Mississippi River basin from southern Wisconsin and eastern Indiana to South Dakota and Wyoming and south to Louisiana. It is also found as an introduced species in Arizona, Alabama, California, Colorado, Illinois, Georgia, Nebraska, North Carolina, South Carolina, Wyoming, Massachusetts, Utah, Virginia, Nevada, and New Mexico.[10]

Invasiveness[edit]

The red shiner is a common bait fish, and the emptying of bait buckets containing them is believed to be the main cause of introduction of this species into new areas. It is also commonly used as an aquarium fish.[10] It has become a species of special concern in the United States, as it has been implicated in the decline of native fish populations in the areas where it has been introduced. As previously mentioned, red shiners have been known to eat the eggs of native fish and in doing so hinder the growth of those populations.[4] They are also adapted to thrive in a variety of environments, and as generalists, may be better able to persist in disturbed habitats than native species of those areas. Red shiners are capable of hybridizing with the blacktail shiner (Cyprinella venusta stigmatura), a native species found in the Coosa River, which serves to dilute the gene pool of this species.[5]

References[edit]

  1. ^ a b c Farringer R.T., III, A.A. Echelle, and S.F. Lehtinen. 1979. Reproductive cycle of the red shiner, Notropis lutrensis, in central Texas and south central Oklahoma. Transactions of the American Fisheries Society, 108, 271-276.
  2. ^ Mayden, R.L. 1989. Phylogenetic studies of North American minnows, with emphasis on the genus Cyprinella (Teleostei: Cypriniformes). The University of Kansas Museum of Natural History, Miscellaneous Publication, 80, 1-189.
  3. ^ Goldstein, R.M., & Simon, T.P. (1999). Toward a united definition of guild structure for feeding ecology of North American freshwater fishes, in T.P. Simon, editor. Assessing the sustainability and biological integrity of water resources using fish communities. CRC Press, Boca Raton, Florida, 123-202
  4. ^ a b Ruppert, J.B., Muth, R.T., Nesler, T.P. (1993). Predation on Fish Larvae by Adult Red Shiner, Yampa and Green Rivers, Colorado. The Southwestern Naturalist, 38(4), 397-399.
  5. ^ a b c d Burkhead, N. M., & Huge, D. H. (2002). The Case of the Red Shiner:What Happens When a Fish Goes Bad? Retrieved October 13, 1872, from USGS: http://fl.biology.usgs.gov/Southeastern_Aquatic_Fauna/Freshwater_Fishes/Shiner_Research/shiner_research.html
  6. ^ Gale, W.F. (1986). Indeterminate fecundity and spawning behavior of captive red shiners - fractions, crevice spawners. Transactions of the American Fisheries Society, 115, 429-437.
  7. ^ Hubbs, C., Kuehne, R.A., Ball, J.C. (1953). The fishes of the upper Guadalupe River. Texas Journal of Science, 5(2), 216-244.
  8. ^ Cross, F.B. (1967). Handbook of fishes of Kansas. University of Kansas Museum of Natural History, Lawrence, 357.
  9. ^ Matthews, W.J., & Hill, L.G. (1979). Influence of physico-chemical factors on habitat selection by red shiners, Notropis lutrensis. Copeia, 70-81.
  10. ^ a b Nico, L., & Fuller, P. (2010). Cyprinella lutrensis. USGS Nonindigenous Aquatic Species Database, Gainesville, FL.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus Notropis and placed in genus (formerly subgenus) Cyprinella by Matthews (1987) and Mayden (1989); this change was adopted in the 1991 AFS checklist (Robins et al. 1991). See Matthews (1987) for information on geographic variation. Broughton and Gold (2000) examined mtDNA variation in Cyprinella and found that this species was not monophyletic and thus may represent multiple species.

C. lepida, recently regarded as a valid species (Matthews 1987), formerly was included in this species. See Mayden (1989) for synonymy.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!