Overview

Comprehensive Description

Biology

Adults inhabit sandy and rocky pools and runs of clear creeks and small rivers (Ref. 205, 10294). Oviparous (Ref. 205), probably open substratum spawners like congeners (Ref. 5723).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Primarily above Fall Line in Tennessee and Alabama river drainages in Alabama, northwestern Georgia, Tennessee, and Virginia. Nearly restricted to Coosa River system above Fall Line in Alabama River drainage (where common); uncommon in Tennessee River drainage (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Primarily above Fall Line in Tennessee and Alabama river drainages in Alabama, northwestern Georgia, Tennessee, and Virginia. Nearly restricted to Coosa River system above Fall Line in Alabama River drainage (where common); uncommon in Tennessee River drainage (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Tennessee and Alabama River drainages in Virginia, Tennessee, northwestern Georgia and Alabama, USA. Nearly restricted to Coosa River system above Fall Line in Alabama River drainage.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 75 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype; Paralectotype for Nototropis lirus Jordan
Catalog Number: USNM 17876
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1876
Locality: Georgia: Rome, Etowah River., Floyd County, Georgia, United States, North America
  • Syntype: Jordan, D. S. 1877. Annals of the Lyceum of Natural History of New York. 11 (11-12): 342.; Paralectotype: Snelson, F. F. 1978. Bulletin of the Florida State Museum, Biological Sciences Series. 23 (1): 55.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Nototropis lirus Jordan
Catalog Number: USNM 101158
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Etowah River, Ga., Georgia, United States, North America
  • Syntype: Jordan, D. S. 1877. Annals of the Lyceum of Natural History of New York. 11 (11-12): 342.; Paralectotype: Snelson, F. F. 1978. Bulletin of the Florida State Museum, Biological Sciences Series. 23 (1): 55.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Nototropis lirus Jordan
Catalog Number: USNM 20138
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1876
Locality: Etowah R Ga, Georgia, United States, North America
  • Syntype: Jordan, D. S. 1877. Annals of the Lyceum of Natural History of New York. 11 (11-12): 342.; Paralectotype: Snelson, F. F. 1978. Bulletin of the Florida State Museum, Biological Sciences Series. 23 (1): 55.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Typically in clear, flowing, riffle-pool type creeks and small rivers with moderate gradients and bottom materials ranging from sand- gravel to rubble-boulder.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Typically in clear, flowing, riffle-pool type creeks and small rivers with moderate gradients and bottom materials ranging from sand-gravel to rubble-boulder.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Generally in small widely scattered populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Peak spawning period apparently in May and June.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lythrurus lirus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCTTTAAGCCTCCTTATTCGAGCTGAACTAAGTCAACCTGGCTCACTCCTAGGTGATGATCAAATCTATAACGTTATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTCTTATTGGTGGATTCGGAAACTGACTTGTTCCTCTAATGATTGGGGCGCCTGATATAGCATTTCCACGAATAAATAACATAAGCTTCTGACTTCTTCCCCCATCATTCCTCTTACTATTAGCCTCTTCTGGTGTTGAAGCCGGGGCTGGTACAGGATGAACTGTTTACCCCCCACTTTCAGGTAATCTTGCCCACGCAGGAGCGTCAGTGGACCTTACAATTTTCTCCCTCCACCTGGCAGGTGTATCATCAATTCTAGGGGCAGTAAATTTCATTACCACAATTATTAATATGAAACCTCCAGCAATCTCTCAGTATCAAACACCCCTCTTCGTATGGGCCGTACTTGTAACTGCCGTTCTCTTACTCCTGTCACTGCCCGTCCTAGCTGCCGGAATTACTATACTTCTCACTGACCGTAACTTAAACACCACATTCTTTGACCCGGCAGGGGGAGGTGATCCTATTCTGTACCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lythrurus lirus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely to be relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely to be relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mountain shiner

Introduction[edit]

Lythrurus lirus or the mountain shiner is one of the 324 fish species found in Tennessee. The species Lythrurus lirus is that not much data has been collected on in the years past. With a monitoring plan that could change. Lythrurus lirus is found in three main states Tennessee, Alabama, and Georgia. In Tennessee and Alabama the species is located in common rivers, and in Virginia the species can be found in drainages in Virginia, Tennessee and Northwestern Georgia. In addition, the species is nearly restricted to the Coosa River system above the Fall Line in the Alabama River drainage. The environment of the species is fresh benthopelagic water, and lives in a temperate range, 38°N-33°N.[1] Lythrurus lirus typically prefers clear flowing creeks and/or small rivers. These waters typically have moderate gradients and bottom materials that range from sand-gravel to rubble-boulders. The population of this species is represented by large subpopulations and locations. However, the total adult population of the Lythrurus lirus is not known specifically, it is speculated to be large. [2] The normal length of the species is typically 6cm but it has been recorded that the maximum length to me 7.5 cm, which was a male. The peek of their mating season is between the months of May and June.[3] The threat of the species is more localized than any other type of threat. However, on a wide range threat level no threat is actually known to the Lythrurus lirus. Currently the species is on a low conservation concern and is not in any dire significant need of managing or monitoring at the moment. [2]

Geographic Distribution[edit]

The species of Lythrurus are commonly found in small streams that are distributed mainly in drainages of the Gulf Coast, locations in the Mississippi Valley, and the Piedmont region of the Atlantic Seaboard. [4] The Lythrurus lirus species normally located above the Fall Line in Tennessee region, and prefers freshwaters that are of temperate climate. The geographical range which it inhabits is from 38°N to 33°N (Lythrurus lirus). Now, the exact population size of the Lythrurus lirus is not known, however, it is assumed to be fairly large. The temporal variation of population size could be subjected to extrinsic factors. An example of this for the population size variance would be the annual, seasonal and even daily level changes that occur in aquatic systems. These fluctuations are a possibly explanation of why there are sometimes subpopulations that are isolated from other populations within the same river or streams. [5] These fluctuations would explain the distribution of some of the populations of the Lythrurus lirus to be scattered within the regions that it inhabits and also the same rivers and streams of different populations.

Ecology[edit]

The Lythrurus lirus prefers benthopelagic freshwater. These waters are typically clear flowing, riffle-type creeks, streams or small rivers. Which these types of waters can range from sand-gravel to rubble-boulder bottoms, and contains moderate levels of gradients. [3] The Lythrurus umbratilis is a sister taxa to the species Lythrurus lirus, which means that the species came from the same diverging point of origin. Therefore, the two species would have similar eating habits. The Lythrurus umbratilis is known to feed on mainly aquatic and terrestrial insects and small invertebrates within the aquatic ecosystem. In addition, the species is also known to often feed on algae. Since these two species are sister taxa it is safely assumed that the Lythrurus lirus as well has the similar feeding habits and most likely feeds on the same organisms. [6]

Now the competition of the Lythrurus lirus consists of mainly of the other species within the same subpopulation of Lythrurus and also other species like darters that are located within the same region. The main predators of this species are larger taxa of fish, which include the different species of trout. [6]

Life History[edit]

Little data has been recorded on the life history of the Lythrurus lirus specifically, but data has been collected on its size, spawning and migrating patterns. The Mountain Shiner, Lythrurus lirus, is a native species to North American and is not documented in other countries. According to a paper done by Shmidt, he states that the maximum length for most species in the Lythrurus genus is less than 70mm. [4] For the Mountain Shiner specifically the average adult size is between 35-55mm. [7] However, some male specimens have been documented to reach a maximum size of 75 mm (Facts About Mountain Shiner). This rare maximum length could be due to the environment as well as nutrients that are available and maybe limited pressure from predators within the aquatic system.

The typically mating season for the Mountain Shiner is in between the time span of May and can end between the months of June/July, depending on location. [7] Now the species does make seasonal migrations throughout the year. However these migrations are not of extensive distances. They travel approximately less than 200 km from their original location. The locations that they will migrate to are normally for either breeding or are winter grounds for hibernation. [3]

Current Management[edit]

Currently, Lythrurus lirus are a least concern species on the red list. With its status as a low conservation concern, the species does not have any significantly required management or monitoring. However, some research actions are being conducted on the species. The Mountain Shiner though has some localized threats that are not a major problem for the species as a whole. However, there seems to be an active production of research to collect more data on the Lythrurus lirus to help better understand the patterns and habits of this species that is common in approximately 3 states. [2]

Even though the species was never listed as a truly endangered species on the Red list, it was listed as low concern species. The main assumption for a problem towards the species of Lythrurus lirus is human interference. [2] One reason for this would be our morphology of the habitats. This can occur with the reduction of streams, dams placed changing the flow of streams connected to rivers and containments that we introduce to the aquatic systems from run off from agriculture lands. These are just a few ideas of what could be the reason for the reduction of the populations due to human interference rather than the natural course of fluctuating water levels that was mention before.

Management Recommendations[edit]

Even though there are approximately eight species in the Lythrurus genus it is but a subgenus of the Notropis genus. [4] This subgenus, along with others, was formed because of historical themes of isolation and divergence within the order itself. This was probably due to divides within the drainage systems between one and each ecosystem that the species inhabited. [8]

Now a management prospect that is running in Canada for the management of the Bridle Shiner is at first a five year program to watch and collect data on the species. This includes collecting data on its migration movements and looking at the impacts on the regions that the species uses as its habitat. [9] This would be a good start to see what is exactly affecting the species sense there is no record for the average population size of the spaces in many regions. The model that was mentioned above would also help with pinpointing areas where to locate and collect efficient data on the Lythrurus lirus species. Then with the added information on the species, effective management can be planned to ensure that the species does flourish like it is now or even at a greater rate in the future, rather than deteriorating without any means of information of why it could possibly be declining.

References[edit]

  1. ^ Lythrurus Lirus, Mountain Shiner. http://www.fishbase.org/summary/2873.
  2. ^ a b c d The IUCN Red List of Threatened Species. http://www.iucnredlist.org/details/202146/0.
  3. ^ a b c Facts about Mountain Shiner (Lythrurus lirus). http://eol.org/pages/217918/details.
  4. ^ a b c Timothy R. Schmidt, Joseph P. Bielawski and John R. Gold Copeia , Vol. 1998, No. 1 (Feb. 3, 1998). Molecular Phylogenetics and Evolution of the Cytochrome b Gene in the Cyprinid Genus Lythrurus (Actinopterygii: Cypriniformes):14-22.
  5. ^ C. Alana Tibbets and Thomas E. Dowling Evolution , Vol. 50, No. 3 (Jun., 1996). Effects of Intrinsic and Extrinsic Factors on Population Fragmentation in Three Species of North American Minnows (Teleostei: Cyprinidae):1280-1292.
  6. ^ a b ARKive. http://www.arkive.org/redfin-shiner/lythrurus-umbratilis/.
  7. ^ a b Mountain Shiners in Alabama. http://www.outdooralabama.com/fishing/freshwater/fish/other/minnow/shiner/mountain/.
  8. ^ Richard L. Mayden and Ronald H. Matson Copeia , Vol. 1992, No. 4 (Dec. 18, 1992). Systematics and Biogeography of the Tennessee Shiner, Notropis leuciodus (Cope) (Teleostei: Cyprinidae):954-968.
  9. ^ Boucher, J., M. Berubé, A. Boyko and M. Bourgeois. 2011. Management plan for the Bridle Shiner (Notropis bifrenatus) in Canada (Final version). Species at Risk Act Management Plan Series, Fisheries and Oceans Canada, Ottawa. v + 43 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus Notropis and placed in genus (formerly subgenus) Lythrurus by Mayden (1989) and Coburn and Cavender (1992); this change was adopted in the 1991 AFS checklist (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!