Overview

Comprehensive Description

Biology

Adults inhabit dimly-lit areas, clinging to walls or ceilings (Ref. 4785). They feed on small invertebrates, especially harpacticoids (Ref. 4785). Eggs are hemispherical and covered with numerous sticky threads that anchor them in the algae on the nesting sites (Ref. 240). Larvae are planktonic which occur primarily in shallow, nearshore waters (Ref. 94114).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Mediterranean Sea. It has been recorded from the Balearic Islands (Spain), southern Sardinia, Tunisia, Israel, Lebanon, Cyprus, and southern Turkey. It is also in the Ligurian Sea (Tunesi and Molinari 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean Sea: Balearic Islands (Spain), southern Sardinia, Algeria, Tunisia, Israel, Lebanon, Cyprus, and southern Turkey.
  • Zander, C.D. 1986 Tripterygiidae. p. 1118-1121. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean, . UNESCO, Paris. Vol. 3. (Ref. 4785)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean Sea endemic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 17 - 19; Dorsal soft rays (total): 10 - 13; Analspines: 2; Analsoft rays: 22 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

5.3 cm TL (male/unsexed; (Ref. 4785)); 4.5 cm NG (female)
  • Zander, C.D. 1986 Tripterygiidae. p. 1118-1121. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean, . UNESCO, Paris. Vol. 3. (Ref. 4785)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body permanently red in color, females and non-territorial males with marbled head; in territorial males black; slightly dark, vertical bars, often white spots and bars along back (Ref. 4785). Territorial males with prolonged rays in second dorsal (Ref. 4785).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A demersal species that inhabits dimly-lit areas, clinging to walls or ceilings (Zander 1986). It feeds on small invertebrates, especially harpacticoids (Zander 1986). Several females lay eggs on substrate of males' territory, often on sponges, eggs are guarded by the male (Zander 1986).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits dimly-lit areas, clinging to walls or ceilings. Feeds on small invertebrates, especially harpacticoids.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Several females lay eggs on substrate of males' territory, often on sponges; eggs are guarded by the male (Ref. 4785).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tripterygion melanurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAAATCTATAATGTAATCGTCACTGCACATGCTTTTGTCATGATCTTCTTTATAGTAATGCCCATCATGATTGGAGGCTTTGGCAACTGACTAATCCCTCTAATAATTGGAGCCCCTGACATGGCTTTCCCTCGAATAAACAACATGAGCTTCTGACTTTTACCTCCTTCTTTCCTTCTACTTTTAGCCTCCTCTGGCGTTGAGGCTGGTGCTGGCACAGGGTGAACAGTATATCCTCCTTTATCAGGCAACCTCGCACACGCCGGGGCCTCGGTAGATCTCACTATTTTCTCCCTCCACTTAGCAGGCATTTCTTCTATCCTAGGGGCCATTAACTTTATTACTACCATTATTAACATGAAACCTGCTGCTATCTCCCAATATCAAACCCCTTTATTTGTATGAGCAGTCCTTATCACGGCAGTACTCCTTCTTCTTTCTCTCCCCGTACTAGCCGCCGGCATTACAATACTTCTCACAGATCGAAATTTAAACACTACCTTCTTTGACCCTGCCGGGGGAGGCGATCCCATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tripterygion melanurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Yokes, B., Pollard, D., Kara, M.H. & Francour, P. and Goren, M.

Reviewer/s
Livingstone, S. & Polidoro, B. and Carpenter, K.

Contributor/s

Justification
This species is widespread and relatively common in the Mediterranean. Currently it is not threatened and is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is not very common in Levant, but is common in Aegean and northwestern Mediterranean.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats for this species. It does not have any commercial interest and is not caught by any fishing techniques.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species specific conservation measures. However this species is found in Marine Protected Areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tripterygion melanurus

Tripterygion melanurus is a species of fish in the family Tripterygiidae, the threefin blennies. It is widespread in the Mediterranean Sea, where it occurs around the Balearic Islands and off the coasts of southern Sardinia, Algeria, Tunisia, Israel, Lebanon, Cyprus, and southern Turkey.[1] It is a marine subtropical demersal fish measuring up to 5.3 centimeters in length.

References[edit]

  1. ^ Tripterygion melanurus at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!