Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

This schooling species inhabits coastal waters. It feeds on fish, crustaceans, foraminiferans, and bivalves (Ref. 5213). The annotated bibliography of Leiognathidae by Pauly and Wade-Pauly (Ref. 4961) includes 172 references pertaining explicitly to Leiognathus splendens.
  • Kimura, S., T. Ito, T. Peristiwady, Y. Iwatsuki, T. Yoshino and P.N. Dunlap 2005 The Leiognathus splendens complex (Perciformes: Leignothidae) with the description of a new species, Leiognathus kupanensis kimura and Peristiwady. Ichthyol. Res. 52 (3):275-291. (Ref. 75583)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is recorded from Tanzania (Zanzibar), Madagascar, Mauritius and the Red Sea, then coastal India through South-east Asia, north to Japan and east as far as Fiji.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: from India to Papua New Guinea; north to Japan; south to Australia,
  • Kimura, S., T. Ito, T. Peristiwady, Y. Iwatsuki, T. Yoshino and P.N. Dunlap 2005 The Leiognathus splendens complex (Perciformes: Leignothidae) with the description of a new species, Leiognathus kupanensis kimura and Peristiwady. Ichthyol. Res. 52 (3):275-291. (Ref. 75583)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 16; Analspines: 3; Analsoft rays: 14; Vertebrae: 24
  • Kimura, S., T. Ito, T. Peristiwady, Y. Iwatsuki, T. Yoshino and P.N. Dunlap 2005 The Leiognathus splendens complex (Perciformes: Leignothidae) with the description of a new species, Leiognathus kupanensis kimura and Peristiwady. Ichthyol. Res. 52 (3):275-291. (Ref. 75583)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

17.0 cm TL (male/unsexed; (Ref. 2045)); max. reported age: 2 years (Ref. 4544)
  • Martosubroto, P. and D. Pauly 1976 R/V Mutiara-IV survey data. November 1974 to July 1976. Marine Fisheries Research Institute. Contributions of the Demersal Fisheries Project No. 3, Jakarta. 136 p. (Ref. 2045)
  • Pauly, D. 1980 The use of pseudo catch-curve for the estimation of mortality rates in Leiognathus splendens (Pisces: Leiognathidae) in Western Indonesian Waters. Meeresforschung 28(1):56-60. (Ref. 4544)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species of the Leiognathus splendens complex is distinguished by the following characters: no scales on cheek; anterior dorsolateral body surface almost completely scaled without a semicircular naked area on nape; lower margin of inner preopercular ridge is smooth or weakly serrated (including the neotype); interspace of pelvic keels without scales; second spines of dorsal and anal fins are robust (width of second spines of dorsal and anal fins 0.87-1.6% of SL and 0.76-1.7% of SL, respectively); a jet black blotch on spinous dorsal fin (Ref. 75583).Description: Belly silvery; back greyish silvery with faint, grey wavy vertical lines above lateral lines in adults; lateral line scales and pectoral fin base yellow; pectoral axil black. Scales small and deciduous. Nuchal spine with a distinct median keel. Chest fully scaled. Mouth horizontal, pointing slightly downward when protracted; line of closed mouth passing below eye; a narrow brown band around end of snout. Lower edge of operculum and margin of supraorbital serrated. Third and fourth dorsal and third anal spines anteriorly serrated (Ref. 2108).
  • Kimura, S., T. Ito, T. Peristiwady, Y. Iwatsuki, T. Yoshino and P.N. Dunlap 2005 The Leiognathus splendens complex (Perciformes: Leignothidae) with the description of a new species, Leiognathus kupanensis kimura and Peristiwady. Ichthyol. Res. 52 (3):275-291. (Ref. 75583)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This common species inhabits shallow coastal waters and estuaries over muddy to sandy-mud substrates, to a depth of about 65 m; smaller individuals are often in mangrove creeks. In northern Australia, it spawns in October although recruits can be found throughout the year (Woodland et al. 2001). Individuals feed on small crustaceans and molluscs as well as plant material.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; amphidromous (Ref. 51243); brackish; marine; depth range 10 - 100 m (Ref. 12260)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Pauly, D., A. Cabanban and F.S.B. Torres Jr. 1996 Fishery biology of 40 trawl-caught teleosts of western Indonesia. p. 135-216. In D. Pauly and P. Martosubroto (eds.) Baseline studies of biodiversity:the fish resource of western Indonesia. ICLARM Studies and Reviews 23. (Ref. 12260)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 7.6 - 61
  Temperature range (°C): 26.130 - 28.013
  Nitrate (umol/L): 0.228 - 1.164
  Salinity (PPS): 34.357 - 35.134
  Oxygen (ml/l): 4.222 - 4.622
  Phosphate (umol/l): 0.081 - 0.311
  Silicate (umol/l): 1.059 - 6.128

Graphical representation

Depth range (m): 7.6 - 61

Temperature range (°C): 26.130 - 28.013

Nitrate (umol/L): 0.228 - 1.164

Salinity (PPS): 34.357 - 35.134

Oxygen (ml/l): 4.222 - 4.622

Phosphate (umol/l): 0.081 - 0.311

Silicate (umol/l): 1.059 - 6.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters of the continental shelf (Ref. 75154). Leiognathus splendens generally lives in turbid waters, and the intensity of its countershading bioluminescence appears to be an adaptation to this (Ref. 2089). Feeds on benthic invertebrates and fish (Ref. 5213) as well as on plankton (Ref. 11889).
  • Venkataraman, G. 1960 Studies on the food and feeding relationships of the inshore fishes off Calicut on the Malabar Coast. Indian J. Fish. 7(2):275-306. (Ref. 3434)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Lipid stored in muscles, liver and intestine decreased during gonadal maturation and following spawning (Ref. 3655).
  • Arora, H.L. 1952 A contribution to the biology of the silver belly, Leiognathus splendens (Cuv.). Indo-Pac. Fish. Counc. Tech. Pap. 4:75-80. (Ref. 3649)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eubleekeria splendens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTATTTGGTGCTTGAGCAGGTATAGTTGGAACAGCCCTAAGCCTGCTAATCCGGGCAGAGCTTAGCCAACCCGGCGCCCTTCTAGGGGAC---GACCACATTTATAATGTTATCGTTACCGCACATGCATTCGTAATAATTTTCTTCATGGTTATACCAATTATAATTGGAGGGTTCGGCAATTGACTCATTCCCTTAATAATTGGAGCCCCCGATATAGCATTTCCCCGAATAAATAATATAAGCTTTTGACTTCTCCCCCCATCCTTCCTTCTTCTCTTGGCATCCTCCGGAATTGAAGCCGGCGCAGGCACAGGATGGACAGTCTACCCCCCCTTAGCAGGAAACCTTGCCCACGCAGGCGCCTCTGTTGACCTGACAATCTTTTCACTTCATCTCGCCGGAATCTCCTCAATTTTAGGGGCTATCAATTTTATCACAACAATTATCAACATAAAACCCCCAGCCATCTCACAGTTCCAAACCCCCCTATTCGTCTGAGCCGTACTAATTACAGCAGTCCTGCTATTACTCTCTCTACCAGTTCTTGCAGCCGGAATCACTATACTATTAACTGACCGAAATCTAAACACCACCTTCTTTGATCCGGCAGGAGGAGGAGACCCAATCCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eubleekeria splendens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Larson, H.

Reviewer/s
Hoese, D. & Pippard, H.

Contributor/s

Justification
This is a widespread and common species with no known major threats to the global population. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Some local fisheries data exists for this species in parts of its range, although this is not specific. It is known to be common and abundant in the wild.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this common species. There may be local impacts from local fisheries in some parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs within several marine protected areas within its wide distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • James, P.S.B.R. 1984 Leiognathidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 2. FAO, Rome. pag. var. (Ref. 3424)
  • Pauly, D. and S. Wade-Pauly 1981 An annotated bibliography of slipmouth (Pisces: Leiognathidae). ICLARM Bibliographies 2. 62 p. (Ref. 4961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eubleekeria splendens

Eubleekeria splendens, common names splendid ponyfish and blacktip ponyfish,[2] is a species of ponyfish.[1]

Description[edit]

Eubleekeria splendens is commonly found at 15 cm in length, but can grow to a length of 17 cm.[3]

Distribution[edit]

This species occurs in the Indo-West Pacific from India in the west, to Papua New Guinea and Fiji to the east, Japan to the north, down to Australia in the south. It has been recorded in the waters of such countries as Tanzania, Madagascar, Mauritius, and is also known to live in the Red Sea.[2][3]

Habitat[edit]

Eubleekeria splendens lives in marine or brackish waters at a maximum depth of 100 metres.[3] It is found in waters with a muddy or sandy mud substrate. It occurs near coasts and in estuaries. Smaller individuals may be found in mangrove creeks.[2]

Diet[edit]

This species eats fish, foraminiferans, bivalves, mollusks and small crustaceans, and is also known to feed on plant matter.[2][3]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!