Articles on this page are available in 1 other language: Arabic (15) (learn more)

Overview

Comprehensive Description

Biology

Inhabit lagoons, subtidal reef flats and outer reef slopes (where it occurs to depths of over 20 m). Often in lives in pairs in empty worm tubes or narrow holes. Mimic the cleaner wrasse Labroides dimidiatus and nip fins, skin and scales of other fishes (Ref. 9710). It even copies the motion of the cleaner wrasse that may induce other fish to come close, but it targets their scales or mucus for a feed, biting and quickly retreating to the corals before the victim realizes that it was tricked; experienced fish recognize imposters and often give it a chase (Ref. 48636). Also feed on tubeworms and demersal fish eggs. Oviparous (Ref. 205). Eggs are demersal and adhesive (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Ocean: Cocos-Keeling Islands (Ref. 9399) and Christmas Island (Ref. 30874) in the eastern Indian Ocean to the Line, Marquesan, and Tuamoto islands, north to southern Japan, south to New South Wales; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Mauritius, Mozambique, Red Sea, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 12; Dorsal soft rays (total): 26 - 28; Analspines: 2; Analsoft rays: 25 - 28
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

11.5 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Bears an amazing resemblance to the cleaner wrasse, Labroides dimidiatus. Distinguished from L. dimidiatus by the position of its mouth, which is terminal in the wrasse but under the snout in the blenny.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

An amazing mimic of the cleaner wrasse Labroides dimidiatus, not only in colour but behaviour. There is a dual basis to the mimicry: the blenny avoids predation in its guise of the wrasse (which is protected because it removes ectoparasites from other fishes) and it gets closer to its prey. It feeds in part by tearing pieces from the fins of other fishes<307>.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 25 m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 1 - 498
  Temperature range (°C): 8.264 - 29.336
  Nitrate (umol/L): 0.050 - 27.282
  Salinity (PPS): 32.200 - 36.142
  Oxygen (ml/l): 3.389 - 4.717
  Phosphate (umol/l): 0.055 - 2.027
  Silicate (umol/l): 0.829 - 20.500

Graphical representation

Depth range (m): 1 - 498

Temperature range (°C): 8.264 - 29.336

Nitrate (umol/L): 0.050 - 27.282

Salinity (PPS): 32.200 - 36.142

Oxygen (ml/l): 3.389 - 4.717

Phosphate (umol/l): 0.055 - 2.027

Silicate (umol/l): 0.829 - 20.500
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit lagoons, subtidal reef flats and outer reef slopes (where it occurs to depths of over 20 m). Often in lives in pairs in empty worm tubes or narrow holes. Mimic the cleaner wrasse Labroides dimidiatus and nip fins, skin and scales of other fishes (Ref. 9710). It even copies the motion of the cleaner wrasse that may induce other fish to come close, but it targets their scales or mucus for a feed, biting and quickly retreating to the corals before the victim realizes that it was tricked; experienced fish recognize imposters and often give it a chase (Ref. 48636). Also feeds on tubeworms and demersal fish eggs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aspidontus taeniatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTCTTTGGTGCATGAGCAGGAATGGTGGGAACGGCCTTAAGCCTCCTCATTCGAGCTGAACTAAGCCAACCTGGGTCTCTCTTAGGGGATGACCAGATTTATAACGTAATTGTTACTGCTCATGCTTTTGTAATAATCTTCTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAACTGATTAGTTCCCTTAATAGTAGGGGCCCCCGATATAGCTTTCCCTCGAATAAACAACATAAGCTTTTGACTTCTCCCCCCTTCTTTTTTACTTTTATTAGCCTCCTCTGGTGTAGAGGCAGGAGCAGGGACAGGCTGAACCGTTTACCCCCCACTCTCAGGAAATCTAGCACATGCAGGGGCATCCGTAGACCTAACTATTTTTTCCCTTCACTTAGCAGGAATCTCCTCAATTCTAGGGGCAATTAATTTTATTACAACTATTATTAATATGAAACCTCCCGCAATTTCACAATATCAGACACCTCTCTTTGTGTGAGCTGTCTTAATTACAGCAGTCTTGCTACTTTTATCTTTACCTGTGCTTGCCGCTGGAATTACTATACTTCTAACTGACCGAAATTTAAATACAACGTTCTTTGACCCTGCTGGAGGAGGAGACCCTATTTTATATCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aspidontus taeniatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

False cleanerfish

The False cleanerfish (Aspidontus taeniatus) is a species of combtooth blenny that mimics the "dance" of Labroides dimidiatus, a similarly colored species of cleaner wrasse. It tricks fish into offering their underparts to be cleaned. Instead of eating parasites from the scales of the fish in a mutualistic cleaning symbiosis, the sabre-toothed blenny bites the victim and rushes away. Fish that have in the past been victimised in that way might attack other blennies innocently trying to groom them.

It is indigenous to coral reef habitats in the Indo-Pacific.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!