Articles on this page are available in 2 other languages: Arabic (15), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit lagoons, subtidal reef flats and outer reef slopes (where it occurs to depths of over 20 m). Often in lives in pairs in empty worm tubes or narrow holes. Mimic the cleaner wrasse Labroides dimidiatus and nip fins, skin and scales of other fishes (Ref. 9710). It even copies the motion of the cleaner wrasse that may induce other fish to come close, but it targets their scales or mucus for a feed, biting and quickly retreating to the corals before the victim realizes that it was tricked; experienced fish recognize imposters and often give it a chase (Ref. 48636). Also feed on tubeworms and demersal fish eggs. Oviparous (Ref. 205). Eggs are demersal and adhesive (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Ocean: Cocos-Keeling Islands (Ref. 9399) and Christmas Island (Ref. 30874) in the eastern Indian Ocean to the Line, Marquesan, and Tuamoto islands, north to southern Japan, south to New South Wales; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 12; Dorsal soft rays (total): 26 - 28; Analspines: 2; Analsoft rays: 25 - 28
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

11.5 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

An amazing mimic of the cleaner wrasse Labroides dimidiatus, not only in colour but behaviour. There is a dual basis to the mimicry: the blenny avoids predation in its guise of the wrasse (which is protected because it removes ectoparasites from other fishes) and it gets closer to its prey. It feeds in part by tearing pieces from the fins of other fishes<307>.
  • Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bears an amazing resemblance to the cleaner wrasse, Labroides dimidiatus. Distinguished from L. dimidiatus by the position of its mouth, which is terminal in the wrasse but under the snout in the blenny.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 25 m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 1 - 498
  Temperature range (°C): 8.264 - 29.336
  Nitrate (umol/L): 0.050 - 27.282
  Salinity (PPS): 32.200 - 36.142
  Oxygen (ml/l): 3.389 - 4.717
  Phosphate (umol/l): 0.055 - 2.027
  Silicate (umol/l): 0.829 - 20.500

Graphical representation

Depth range (m): 1 - 498

Temperature range (°C): 8.264 - 29.336

Nitrate (umol/L): 0.050 - 27.282

Salinity (PPS): 32.200 - 36.142

Oxygen (ml/l): 3.389 - 4.717

Phosphate (umol/l): 0.055 - 2.027

Silicate (umol/l): 0.829 - 20.500
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit lagoons, subtidal reef flats and outer reef slopes (where it occurs to depths of over 20 m). Often in lives in pairs in empty worm tubes or narrow holes. Mimic the cleaner wrasse Labroides dimidiatus and nip fins, skin and scales of other fishes (Ref. 9710). It even copies the motion of the cleaner wrasse that may induce other fish to come close, but it targets their scales or mucus for a feed, biting and quickly retreating to the corals before the victim realizes that it was tricked; experienced fish recognize imposters and often give it a chase (Ref. 48636). Also feeds on tubeworms and demersal fish eggs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Aspidontus taeniatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Aspidontus taeniatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTCTTTGGTGCATGAGCAGGAATGGTGGGAACGGCCTTAAGCCTCCTCATTCGAGCTGAACTAAGCCAACCTGGGTCTCTCTTAGGGGATGACCAGATTTATAACGTAATTGTTACTGCTCATGCTTTTGTAATAATCTTCTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAACTGATTAGTTCCCTTAATAGTAGGGGCCCCCGATATAGCTTTCCCTCGAATAAACAACATAAGCTTTTGACTTCTCCCCCCTTCTTTTTTACTTTTATTAGCCTCCTCTGGTGTAGAGGCAGGAGCAGGGACAGGCTGAACCGTTTACCCCCCACTCTCAGGAAATCTAGCACATGCAGGGGCATCCGTAGACCTAACTATTTTTTCCCTTCACTTAGCAGGAATCTCCTCAATTCTAGGGGCAATTAATTTTATTACAACTATTATTAATATGAAACCTCCCGCAATTTCACAATATCAGACACCTCTCTTTGTGTGAGCTGTCTTAATTACAGCAGTCTTGCTACTTTTATCTTTACCTGTGCTTGCCGCTGGAATTACTATACTTCTAACTGACCGAAATTTAAATACAACGTTCTTTGACCCTGCTGGAGGAGGAGACCCTATTTTATATCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

False cleanerfish

The false cleanerfish, (Aspidontus taeniatus), is a species of combtooth blenny, a Batesian mimic that copies both the dance and appearance of Labroides dimidiatus, a similarly colored species of cleaner wrasse. Likely mimicking the bluestreak cleaner wrasse to avoid predation,[1] as well to occasionally bite the fins of its victims rather than consume parasites.[2][3] Most veiled attacks occur on juvenile fish, as adults that have been attacked in the past may avoid or even attack A. taeniatus.[4]

It is indigenous to coral reef habitats in the Indo-Pacific.

Mimicry[edit]

Appearance[edit]

The false cleanerfish primarily lives in coral reef margins among the cleaning stations of the bluestreak cleaner wrasse (Labroides dimidiatus),[1] and are usually seen near locations of one or more L. dimidiatus.[5] With its territory primarily overlapping with its model fish, the false cleanerfish mimics both the appearance and occasionally the behavior of said fish. Though A. taeniatus is typically known to exhibit the characteristic black stripe and blue body and general body shape and structure of L. dimidiatus,[4] some individuals have been witnessed to mimic the appearance of other reef fish, as well as atypically colored cleaner wrasses that live in the same territory.[4][6]

Juvenile A. taeniatus fish match the appearance of juvenile L. dimidiatus (black body, blue dorsal stripe), and continue to match the coloration of cleaner wrasses of the same size throughout growth.[4][5] It is not known whether the false cleanerfish adopts a permanent color pattern or if it alters its coloration to mimic the appearance of neighboring cleaner wrasses.

One major difference in appearance between the false cleanerfish and its model is the location of the mouth. A. taeniatus has an underslung mouth, whereas L. dimidiatus has its mouth in the terminal position.[5] Additionally, the false cleanerfish has a small set teeth on the upper mandible, as well as enormous canines that protrude from its lower jaw and fit into sockets laterally on the roof of its mouth.[5]

Cheating behavior[edit]

The false cleanerfish has been observed to mimic the unusual “dance” of the bluestreak cleaner wrasse by spreading its caudal fin and oscillating its posterior end up and down.[2] By doing so, the false cleanerfish elicits the same posing behavior in client fish, similarly to L. dimidiatus.[1][2] Occasionally, however, rather than feeding on ectoparasites like the cleaner wrasse, the false cleanerfish will attack and attempt and sometimes succeed at tearing away portions of fin from the client fish.[1][2][6][7] This typically occurs and is most successful with juvenile client fish,[5] as adults have been evidenced to avoid or even indiscriminately attack cleanerfish, suggesting adult client fish remember being attacked.[8] Also, evidence indicates adult fish are able to distinguish between L. dimidiatus and A. taeniatus, and thus avoid it altogether.[4][5][6]

Evolutionary basis[edit]

Though A. taeniatus mimics L. dimidiatus in color, morphology, and mode of swimming, the false cleanerfish cheats much less often than initially reported.[1] The stomach contents of A. taeniatus consist primarily of the demersal eggs of fishes and the tentacles of tube worms,[1][5] with a relatively small portion of fish fins, or ectoparasites[9]—the primary stomach contents of L. dimidiatus. Additionally, close observation of A. taeniatus has shown them to only attack posing clients at a rate of about 20%.[1]

The primary reason for the false cleanerfish’s mimicry is suggested to be not to cheat and feed on the flesh of client fish, but to avoid predation by those fish that do not prey on L. dimidiatus.[1] Aggressive mimicry typically results in the complete consumption of prey by a mimic predator (such as anglerfish), or partial consumption of prey by an unattractive mimic.[1] In both cases, the host fish can rarely or never learn the disguise of the mimic; the fact that A. taeniatus can be easily identified by client fish helps to dispel the notion that it is primarily an aggressive mimic.[8] Groupers raised in captivity do not attack L. dimidiatus, while they do consume all other noncleanerfish on sight.[10] Furthermore, false cleanerfish inflict a higher cost on their models and cleaning stations when cheating, as client fish are more likely to behave aggressively or avoid cleaning stations altogether if they are consistently attacked.[11]

However, there is evidence of geographical variation on the benefits obtained by the mimicry: whereas in the Red Sea and the Great Barrier Reef foraging on tube worms or substrate was more common than attacks by mimics, in French Polynesia and Indonesia false cleanerfish (especially juveniles) fed on client fish tissue more commonly than other food sources.[3] An alternate reason for the mimicry behavior of A. taeniatus is to deceive egg-caring fishes so to more easily gain access to their eggs; however, little evidence favors this possibility.[1]

The evolution of A. taeniatus to mimic L. dimidiatus has been used as evidence for the strong selection of client fish that do not attack their cleaners, or cheat and consume their cleaners after cleaning.[12] Furthermore, the behavior of A. taeniatus mimicking L. dimidiatus in a largely nonaggressive way supports the hypothesis of the evolution of reciprocally altruistic behavior.[12]

References[edit]

  1. ^ a b c d e f g h i j Kuwamura, Tetsuo (2 October 1983). "Reexamination on the Aggressive Mimicry of the Cleaner Wrasse Labroides dimidiatus by the Blenny Aspidontus taeniatus (Pisces; Pereiformes)". Journal of Ethology 1 (1-2): 22–33. doi:10.1007/BF02347828. 
  2. ^ a b c d Wickler, W. (29 December 1966). "Mimicry in Tropical Fishes". Philosophical Transactions of the Royal Society of London. B, Biological Sciences 251 (772): 473–474. doi:10.1098/rstb.1966.0036. 
  3. ^ a b Cheney, K. (2014). "Geographical variation in the benefits obtained by a coral reef fish mimic". Animal Behaviour. doi:10.1016/j.anbehav.2013.11.006. 
  4. ^ a b c d e Randall, John E. (3 April 2005). "A Review of Mimicry in Marine Fishes". Zoological Studies 44 (3): 299–328. 
  5. ^ a b c d e f g Randall, John E.; Helen A. Randall (4 November 1960). "Examples of Mimicry and Protective Resemblance in Tropical Marine Fishes". Bulletin of Marine Science of the Gulf and Caribbean 10 (4): 444–480. 
  6. ^ a b c Victor Springer; William Smith-Vaniz (1972). Smithsonian Contributions to Zoology (Volume 112 ed.). Smithsonian Inst. Press. p. 36. 
  7. ^ Poulin, Robert; William L. Vickery (7 July 1995). "Cleaning Symbiosis as an Evolutionary Game: To Cheat or not to Cheat?". Journal of Theoretical Biology 175 (1): 63–70. doi:10.1006/jtbi.1995.0121. 
  8. ^ a b Cheney, Karen (27 February 2008). "The role of avoidance learning in an aggressive mimicry system". Behavioral Ecology 19 (3): 583–588. doi:10.1093/beheco/arn001. 
  9. ^ Eibl-Eibesfeldt, Irenäus (1959). "Der Fisch Aspidontus taeniatus als Nachahmer des Putzers Labroides dimidiatus". Zeitschrift für Tierpsychologie 16 (1): 19–25. doi:10.1111/j.1439-0310.1959.tb02176.x. 
  10. ^ Hediger, H. (1968). "Putzer-fische im aquarium". Natur und Museum 98: 89–96. 
  11. ^ Cheney, Karen L. (24 August 2011). "Cleaner wrasse mimics inflict higher costs on their models when they are more aggressive towards signal receivers". Biology Letters 8 (1): 10–12. doi:10.1098/rsbl.2011.0687. 
  12. ^ a b Trivers, Robert L. (March 1971). "The Evolution of Reciprocal Altruism". The Quarterly Review of Biology 46 (1): 35–57. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!