Overview

Comprehensive Description

Biology

Found in lagoon and seaward reefs to depths greater then 30 m; juveniles in sheltered inner reef areas (Ref. 9710, 48637). Adults usually occur in pairs. Juveniles solitary and commonly among staghorn corals in lagoons or protected reefs (Ref. 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to southern Great Barrier Reef (Queensland, Australia), New Caledonia and
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: Red Sea south to Natal, South Africa and east to India, Java, and Cocos-Keeling Islands, but not Christmas Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 3146))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 25 m (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 150 - 150
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Zebrasoma desjardinii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGAACAGCTCTAAGCCTACTCATCCGAGCAGAACTCAGCCAACCGGGCGCTCTCCTTGGGGACGACCAGATCTACAATGTAATCGTTACAGCACATGCATTTGTAATGATTTTCTTTATAGTTATACCAATCATGATTGGGGGATTCGGAAACTGGCTGATTCCACTAATGATTGGAGCCCCTGACATAGCATTCCCACGAATGAATAACATGAGCTTTTGACTTCTCCCGCCATCCTTCCTCCTTCTCCTTGCCTCCTCAGGCGTTGAAGCCGGGGCTGGCACAGGATGAACAGTATACCCCCCTCTGGCAGGCAATCTAGCGCATGCTGGGGCATCCGTAGACTTAACTATCTTCCCCCTCCATCTCGCGGGGATTTCATCAATTCTAGGGGCTATTAATTTTATTACAACTATTATTAACATAAAACCTCCCGCTATTTCACAATACCAAACCCCCCTATTTGTGTGAGCGGTCCTAATCACAGCTGTCTTACTTCTCCTCTCCCTTCCAGTTCTTGCTGCAGGGATTACAATGCTCCTCACAGACCGAAACCTAAATACTACCTTCTTCGACCCTGCGGGAGGAGGAGACCCCATTCTTTACCAACATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Zebrasoma desjardinii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red Sea sailfin tang

The Red Sea sailfin tang or Desjardin's sailfin tang (Zebrasoma desjardinii) is a marine reef tang in the fish family Acanthuridae.

Contents

Description

Zebrasoma desjardinii grows to a maximum length of 40 cm (16 in), with a sexual dimorphism, as males being larger than females. This species shows the typical morphology of the family Acanthuridae. The body is oval or disc-shaped, with erectile and much elevated dorsal and anal fins. The coloration may vary from one individual to another and within the same individual, depending on age. In general, the upper side of the body alternates orange and dark blue vertical bands, with a larger blue band on the eyes, a spotted ventral region and numerous white spots on the head. The dorsal and anal fins have a pattern of horizontal alternate orange and blue bands. The caudal fin shows white spots and lines.

Like most surgeonfish on each side of the caudal fin, in the middle of the caudal peduncle, there is a defensive dark spine surrounded by a blue zone. This spine is hinged and may unfolds to 80°.

In respect of Zebrasoma veliferum, adult Red Sea Sailfin tang has a few less anal fin rays (22-24 instead of 23-26) and different marking on the tail. As a juvenile, they are almost indistinguishable in color and markings.

Zebrasoma desjardinii displaying its soft dorsal and anal fins

Behavior

Adults usually can be found in pairs, while juveniles are solitary. When threatened, these fishes display their large ventral and dorsal fins. They feed primarily on filamentous algae, various macroalgae and plankton. They are pair spawners, a typical trait of other fish in the Zebrasoma genus. This differs from the group spawning typical of the Acanthuridae family.

Distribution

This species is widespread in the Indian Ocean from the southern Red Sea to KwaZulu-Natal Province in South Africa and as far east as India and Java.

Habitat

Red Sea sailfin tangs natively live in lagoons and reefs in a tropical climate. The juvenile fishes live in the inner reef areas. They prefer saltwater with a specific gravity of 1.020 - 1.025, a pH between 8.1 and 8.4 and an ideal temperature range of 22 - 26 C (72 - 78 F). They may live at water depths of 2 – 30 m (6.5 – 100 ft) or more.

Bibliography

  • Sprung, Julian y Delbeek, J.Charles. - The Reef Aquarium. Ricordea Publishing. 1994.
  • Debelius, Helmut y Baensch, Hans A. Atlas Marino. Mergus. 1997.
  • Michael, Scott W. (en inglés) Reef aquarium fishes. Microcosm.T.F.H. 2005.
  • Nilsen, A.J. y Fossa, S.A. - Reef Secrets. TFH Publications .2002.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!