Overview

Comprehensive Description

Description

  Common names: flounder (English), lenguado (Espanol)
 
Paralichthys californicus (Ayres, 1859)


Fine flounder


Body height 38-40% of SL; head length 23-32% of SL; eyes on left side, relatively small, separated by a flat space without a ridge; mouth long, 45-50% of head length, ends under or behind rear edge of eye; teeth are large canines, especially at front of mouth; 25-32 gill rakers; dorsal fin begins over upper eye,  66-76; anal fin 49-59; bases of pelvics symmetric; urinary papilla on eye side, immediately behind level of anus; lateral line scales 93-117; eye-side scales rough, large fish with small accessory scales between larger body scales; blind side scales smooth; lateral line extending onto head, with branches to upper eye and below lower eye, strongly arched over pectoral fin.

Eye side greenish brown to black, with darker and lighter mottling and spots.

Size: 152 cm.

Habitat: sandy bottoms; marine and brackish water.

Depth: 1-183 m.

Washington State to southern Baja.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Lives mostly on sandy bottoms. Common beyond surf line, also in bays and estuaries. Occurs from near shore to 183 m depth. Feeds during the day (Ref. 9643) on fishes and squids, often well off the bottom. An important sport and commercial fish. Also caught with trammel nets (Ref. 9330). Marketed as fresh fillet (Ref. 9330). Adults migrate to shallower waters to spawn (Ref. 9643). Has very sharp teeth and is known to bite if handled (Ref. 13513).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 1 (S) - 183 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California halibut are found along the Pacific coast of North America, ranging from the Quillayute River, Washington, to Baja California, Mexico.

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from Washington state, USA to Magdalena Bay, Baja California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Quillayute River in northern Washington, USA to southern Baja California, Mexico. Also in northern the Gulf of California (Ref. 9330).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific off northern U.S A. south to Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 152.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California halibut are large, oval-shaped flatfish, with a symmetrical mouth and sharp, canine-like teeth. They have long gill rakers and relatively small eyes. Olfactory rosettes and cephalic lateralis pores are found on their snout and jaw, respectively. At the beginning of the larval stage, one eye is on each side of the head. As individuals mature into the postlarval stage (at 20 to 29 days), one of the eyes migrates to the other side, leaving the animal with 2 eyes on the 'dorsal' side (which technically is still its lateral side). The body is firm, with paired pectoral fins and a wide caudal fin, which is used for rapid propulsion. Coloration is normally brown to brownish-black on the dorsum, and white on the ventral side. The chromatophores in the skin are capable of changing the animal's color and patterning to match its environment. The lateral line is arched above the pectoral fin. California halibut reach a maximum size of 152 cm and a mass of 33 kg.

California halibut may be confused with Pacific halibut (Hippoglossus stenolepis). These two species can be distinguished by the length of the maxilla, which reaches beyond the eye in California halibut (versus just reaching the front edge of the eye in Pacific halibut), and the number of dorsal fin rays, which is always less than 77 in California halibut (versus 80 or more in Pacific halibut).

Range mass: 33 (high) kg.

Range length: 152 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1520 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

152 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 33.0 kg (Ref. 9330); max. reported age: 30 years (Ref. 33520)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Water column

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California halibut are a benthic species that inhabits sandy bottoms to depths of 183 m. They congregate in the nearshore waters and embayments of California.

Juveniles live in nursery bays and migrate to sandy areas along the coast as they grow. Males mature faster than females, and leave nursery areas for the open coast at 2 to 3 years of age and 20 to 23 cm in length, while females migrate as slightly larger sub-adults, at a length of around 25 cm.

Range depth: 183 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic ; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species lives on soft sand and sandy mud bottoms in coastal areas to depths of 180 m. It can also be found in larger bays and estuaries.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 183 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 1 - 12
  Temperature range (°C): 18.831 - 22.948
  Nitrate (umol/L): 0.133 - 2.687
  Salinity (PPS): 33.781 - 35.311
  Oxygen (ml/l): 4.912 - 5.364
  Phosphate (umol/l): 0.352 - 0.885
  Silicate (umol/l): 2.488 - 7.399

Graphical representation

Depth range (m): 1 - 12

Temperature range (°C): 18.831 - 22.948

Nitrate (umol/L): 0.133 - 2.687

Salinity (PPS): 33.781 - 35.311

Oxygen (ml/l): 4.912 - 5.364

Phosphate (umol/l): 0.352 - 0.885

Silicate (umol/l): 2.488 - 7.399
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 183m.
Recorded at 183 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California halibut are carnivorous, with their diet changing in association with growth. They feed both during the day and night, but appear to favor catching prey during the day. Juveniles (less than 55 mm) feed mainly on small crustaceans, such as harpacticoid copepods, small gammarid amphipods, and mysid shrimps. As they grow to 55 to 230 mm, they feed on shrimp and small fishes, such as gobies, topsmelt (Atherinops affinis), and California killifish (Fundulus parvipinnis). As juveniles grow and migrate out of protected bays, their diet switches yet again, to larger, faster-swimming prey. Young adult and mature California halibut are known to feed on northern anchovies (Engraulis mordax) and mysids.

Halibut partially or completely bury themselves in the sand (leaving the eyes exposed) to hide from their prey. They wait and watch the prey item until it is less than three head lengths away, and then strike with a swift upward lunging motion, snatching it. If the strike fails, they will chase the prey until it is captured.

Animal Foods: fish; aquatic or marine worms; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lives mostly on sandy bottoms. Common beyond surf line, also in bays and estuaries. Occurs from near shore to 183 m depth. Feeds during the day on fishes and squids, often well off the bottom. Adults migrate to shallower waters to spawn (Ref. 9643).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

California halibut play a crucial role in the neritic food chain, as they are a vital source of food for predators, in addition to being secondary and tertiary consumers themselves.

Mutualism and commensalism between this species and others has not been observed, but it is known to host a number of endo- and ectoparasites. Known endoparasites include flukes, tapeworms, and nematodes, which infest the intestinal tract. Ectoparasites include copepods and isopods, which attach themselves to the gills and scales.

Commensal/Parasitic Species:

  • Acanthochondria solea (Subclass Copepoda, Subphylum Crustacea)
  • Holobomalochus prolixus (Subclass Copepoda, Subphylum Crustacea)
  • Lepeophtheirus bufidis (Subclass Copepoda, Subphylum Crustacea)
  • Taenicanthodes haakeri (Subclass Copepoda, Subphylum Crustacea)
  • Spirocamallanus pereirai (Family Camallanidae, Phylum Nematoda)
  • Stephanostomum casum (Class Trematoda, Phylum Platyhelminthes)
  • Tubulovesicula linbergi (Class Trematoda, Phylum Platyhelminthes)
  • Echeneibothrum (Class Cestoda, Phylum Platyhelminthes)
  • Elthusa vulgaris (Order Isopoda, Subphylum Crustacea)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Juvenile California halibut may be preyed upon by shorebirds, waterfowl, and larger fishes while they reside in shallow bays. Adult California halibut in coastal regions are fed on by Pacific angel sharks, Pacific electric rays, California sea lions, and bottlenose dolphins. In some cases, larger halibut are known to feed on their smaller counterparts.

In order to avoid predators, California halibut bury themselves in the sand and use their camouflage abilities to blend in with the sea bottom. Due to their well-developed swimming abilities, they are also able to escape from some of their predators even if they are detected.

Known Predators:

  • Pacific angel sharks (Squatina californica)
  • Pacific electric rays (Torpedo californica)
  • California sea lions (Zalophus californianus)
  • bottlenose dolphins (Tursiops truncatus)
  • humans (Homo sapiens)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication in California halibut has not been extensively studied or observed. They are able to use their lateral line to detect vibrations in the water, aiding in prey location and predator avoidance. Because one of the eyes migrates to the other side of the head, and because the eyes are sensitive to patterns, they are able to lay flat on the bottom of the ocean, camouflaging themselves and enabling them to better spot their prey. This species is also able to sense chemical cues in the water, using the olfactory rosettes found in its nares.

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Larvae hatch at about 2 mm in length, and undergo a change in form 20 to 29 days post-hatching, after which they settle to the bottom of bays when the larvae attain sizes between 7.5 to 9.4 mm. Paralichthys californicus is unique in that 20 to 29 days after its larval stage, one of its eyes migrates to the same side as the other eye. It can either be dextral or sinistral, meaning that both the eyes may be located on the right or left side of its head.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

California halibut live for up to 30 years in the wild. A study has shown that California halibut are generally older in Southern California, as opposed to Central California. Little is known about their longevity in captivity.

Range lifespan

Status: wild:
30 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California halibut reproduce by broadcast spawning in shallow waters of coastal areas; eggs are fertilized externally.

Mating System: polygynandrous (promiscuous)

Males become sexually mature at 2 to 3 years of age and a standard length of 20 to 23 cm. Females mature later, at 4 to 5 years and 38 to 43 cm in standard length. Spawning season occurs from February to August, most commonly taking place in May. California halibut eggs are 0.7 to 0.8 mm in size and are mainly found close to the shore, in shallow water between 12 and 45 m.

Breeding interval: California halibut breed once yearly.

Breeding season: Spawning may occur from February to August, but most commonly happens in May.

Average number of offspring: 420,000 eggs.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

There is no parental investment, as this species is a broadcast spawner with planktonic larvae.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paralichthys californicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGAACAGCCCTAAGTCTTCTCATTCGAGCAGAACTTAGCCAACCTGGAGCTCTCCTGGGAGACGACCAAGTTTATAATGTAATCGTCACCGCACACGCCTTTGTAATAATCTTTTTCATGGTTATACCAATTATGATCGGGGGTTTTGGCAACTGACTCATCCCCCTAATAATTGGCGCCCCAGATATGGCATTCCCTCGAATGAACAATATAAGCTTCTGACTCTTGCCCCCCTCATTCCTGCTTCTCCTAGCTTCTTCAGGTGTCGAAGCTGGAGCCGGCACCGGATGAACCGTTTACCCCCCTTTAGCCAGTAACCTGGCCCATGCTGGAGCCTCGGTAGATCTCACTATCTTTTCACTTCACCTTGCAGGTATTTCCTCTATCCTAGGGGCTATCAACTTCATTACTACCATCATTAACATAAAACCCACCACTGTAACCATATATCAAATCCCACTGTTTGTCTGAGCTGTCTTAATTACAGCAGTCCTACTACTTCTCTCCCTTCCAGTCCTAGCCGCTGGAATTACAATACTGCTCACAGACCGAAACCTGAATACAACTTTCTTTGACCCTGCGGGAGGAGGGGATCCCATCCTTTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Paralichthys californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In 2011, the California Department of Fish and Game completed its first stock assessment of the California halibut population in Southern California. An independent panel review found numerous problems with inadequate sampling and other deficiencies in the data provided by this assessment, but nonetheless found that the population was depleted to about 14% of its unexploited level, and noted that recruitment had declined sharply since 1999. However, no conservation initiatives have yet been enacted for this species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Lea, B. & van der Heiden, A.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and its population is stable in the United States. It is a popular species for sport and commercial fishing, however this is not thought to pose any significant threat. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population for this species appears to be stable in the majority of its range off the coast of California (Haugen 1990). Thjs species has shown a historical decline in commercial landings from a maximum of 5,000,000 lbs in 1919, mainly due to overfishing. In the late 1950s and 1960s, there was a slight increase in landings following warmer waters during El Niño events. Annual landings in 1970 were a historical low of 257,000 lb. Since 1980 however, landings have been relatively stable and average a little more than 1 million lb annually (California Fish and Game 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species population is likely limited by the amount of available nursery habitat, as juvenile halibut appear to be dependent on shallow water embayments as nursery areas. The overall decline in halibut landings is considered to correspond to a decline in shallow water habitats in southern California associated with dredging and filling of bays and wetlands (California Dept of Fish and Game 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The fishing of this species is stricty regulated in the USA, and it is recommended that similar measures should be implemented in Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

California halibut have not been known to cause any significant problems or harm to humans. However, they have very sharp teeth and will potentially bite, if handled.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California halibut are widely sold and consumed by humans. The species has supported recreational and commercial fisheries throughout the west coast of North America since the early twentieth century. According to the Department of Fish and Game, 239,558 kg of California halibut were landed in 2010. The total value, computed from prices paid to fishermen, was estimated at $2,347,179.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

California halibut

A well camouflaged California halibut

The California halibut or California flounder, Paralichthys californicus, is a large-tooth flounder native to the waters of the Pacific Coast of North America from the Quillayute River in Washington to Magdalena Bay in Baja California. It feeds near shore and is free swimming. It typically weighs 6 to 50 pounds (3 to 23 kg). It is much smaller than the larger and more northern-ranging Pacific halibut that can reach 300 pounds (140 kg).

A top level predator that hunts by stealth, it is prized by fishermen as great table fare.

Sport fishers typically use light fishing gear and live baits for this halibut. Baits include anchovies, sardine, squid, mackerel, and queenfish (brownbait). Some anglers use plastic lures and scampitype "lead heads" to fool a halibut into striking.

Mostly fishing from boats in the coastal regions, anglers catch good quantities of halibut in 10 to 80 feet of water. Sometimes the fish are caught from shore or by kayak fishermen in very shallow water. Slow trolling and drift fishing is the preferred method of bait presentation.

This is an unusual fish in that one eye has to migrate around from one side to the other as it grows from an upright fry or baby fish into an adult fish that lies on its side. The adult has two eyes on the up-side as it lies on the bottom. Most flatfish are generally either right-eyed or left-eyed, but the California halibut is unusual in having a roughly even number of each type. Like other flatfish, the halibut hides under sand or loose gravel and blends into the bottom.

Sportfishing[edit]

The halibut is loved as a sport fishing target species and prized by fishermen of the southern California coastline. It has been taken frequently from shore by surf fishermen. It is sometimes caught from the rocks or near piers. However the most common way to catch them is from a boat with a live bait while drifting across the water. Santa Monica Bay and Los Angeles Harbor are famous for the success of catching them this way.

A fishing event in Santa Monica Bay relies on this love of halibut fishing to produce an annual charity fishing event, The Marina Del Rey Halibut Derby.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!