Overview

Comprehensive Description

Description

  Common names: flounder (English), lenguado (Espanol)
 
Paralichthys californicus (Ayres, 1859)


Fine flounder


Body height 38-40% of SL; head length 23-32% of SL; eyes on left side, relatively small, separated by a flat space without a ridge; mouth long, 45-50% of head length, ends under or behind rear edge of eye; teeth are large canines, especially at front of mouth; 25-32 gill rakers; dorsal fin begins over upper eye,  66-76; anal fin 49-59; bases of pelvics symmetric; urinary papilla on eye side, immediately behind level of anus; lateral line scales 93-117; eye-side scales rough, large fish with small accessory scales between larger body scales; blind side scales smooth; lateral line extending onto head, with branches to upper eye and below lower eye, strongly arched over pectoral fin.

Eye side greenish brown to black, with darker and lighter mottling and spots.

Size: 152 cm.

Habitat: sandy bottoms; marine and brackish water.

Depth: 1-183 m.

Washington State to southern Baja.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Lives mostly on sandy bottoms. Common beyond surf line, also in bays and estuaries. Occurs from near shore to 183 m depth. Feeds during the day (Ref. 9643) on fishes and squids, often well off the bottom. An important sport and commercial fish. Also caught with trammel nets (Ref. 9330). Marketed as fresh fillet (Ref. 9330). Adults migrate to shallower waters to spawn (Ref. 9643). Has very sharp teeth and is known to bite if handled (Ref. 13513).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Eastern Pacific, and is found from Washington state, USA to Magdalena Bay, Baja California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Quillayute River in northern Washington, USA to southern Baja California, Mexico. Also in northern the Gulf of California (Ref. 9330).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific off northern U.S A. south to Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 183 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 152.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1520 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

152 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 33.0 kg (Ref. 9330); max. reported age: 30 years (Ref. 33520)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species lives on soft sand and sandy mud bottoms in coastal areas to depths of 180 m. It can also be found in larger bays and estuaries.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 183 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 1 - 12
  Temperature range (°C): 18.831 - 22.948
  Nitrate (umol/L): 0.133 - 2.687
  Salinity (PPS): 33.781 - 35.311
  Oxygen (ml/l): 4.912 - 5.364
  Phosphate (umol/l): 0.352 - 0.885
  Silicate (umol/l): 2.488 - 7.399

Graphical representation

Depth range (m): 1 - 12

Temperature range (°C): 18.831 - 22.948

Nitrate (umol/L): 0.133 - 2.687

Salinity (PPS): 33.781 - 35.311

Oxygen (ml/l): 4.912 - 5.364

Phosphate (umol/l): 0.352 - 0.885

Silicate (umol/l): 2.488 - 7.399
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 183m.
Recorded at 183 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Water column

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Lives mostly on sandy bottoms. Common beyond surf line, also in bays and estuaries. Occurs from near shore to 183 m depth. Feeds during the day on fishes and squids, often well off the bottom. Adults migrate to shallower waters to spawn (Ref. 9643).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paralichthys californicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGAACAGCCCTAAGTCTTCTCATTCGAGCAGAACTTAGCCAACCTGGAGCTCTCCTGGGAGACGACCAAGTTTATAATGTAATCGTCACCGCACACGCCTTTGTAATAATCTTTTTCATGGTTATACCAATTATGATCGGGGGTTTTGGCAACTGACTCATCCCCCTAATAATTGGCGCCCCAGATATGGCATTCCCTCGAATGAACAATATAAGCTTCTGACTCTTGCCCCCCTCATTCCTGCTTCTCCTAGCTTCTTCAGGTGTCGAAGCTGGAGCCGGCACCGGATGAACCGTTTACCCCCCTTTAGCCAGTAACCTGGCCCATGCTGGAGCCTCGGTAGATCTCACTATCTTTTCACTTCACCTTGCAGGTATTTCCTCTATCCTAGGGGCTATCAACTTCATTACTACCATCATTAACATAAAACCCACCACTGTAACCATATATCAAATCCCACTGTTTGTCTGAGCTGTCTTAATTACAGCAGTCCTACTACTTCTCTCCCTTCCAGTCCTAGCCGCTGGAATTACAATACTGCTCACAGACCGAAACCTGAATACAACTTTCTTTGACCCTGCGGGAGGAGGGGATCCCATCCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Paralichthys californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Lea, B. & van der Heiden, A.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and its population is stable in the United States. It is a popular species for sport and commercial fishing, however this is not thought to pose any significant threat. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population for this species appears to be stable in the majority of its range off the coast of California (Haugen 1990). Thjs species has shown a historical decline in commercial landings from a maximum of 5,000,000 lbs in 1919, mainly due to overfishing. In the late 1950s and 1960s, there was a slight increase in landings following warmer waters during El Niño events. Annual landings in 1970 were a historical low of 257,000 lb. Since 1980 however, landings have been relatively stable and average a little more than 1 million lb annually (California Fish and Game 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species population is likely limited by the amount of available nursery habitat, as juvenile halibut appear to be dependent on shallow water embayments as nursery areas. The overall decline in halibut landings is considered to correspond to a decline in shallow water habitats in southern California associated with dredging and filling of bays and wetlands (California Dept of Fish and Game 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The fishing of this species is stricty regulated in the USA, and it is recommended that similar measures should be implemented in Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

California halibut

A well camouflaged California halibut

The California halibut or California flounder, Paralichthys californicus, is a large-tooth flounder native to the waters of the Pacific Coast of North America from the Quillayute River in Washington to Magdalena Bay in Baja California. It feeds near shore and is free swimming. It typically weighs 6 to 50 pounds (3 to 23 kg). It is much smaller than the larger and more northern-ranging Pacific halibut that can reach 300 pounds (140 kg).

A top level predator that hunts by stealth, it is prized by fishermen as great table fare.

Sport fishers typically use light fishing gear and live baits for this halibut. Baits include anchovies, sardine, squid, mackerel, and queenfish (brownbait). Some anglers use plastic lures and scampitype "lead heads" to fool a halibut into striking.

Mostly fishing from boats in the coastal regions, anglers catch good quantities of halibut in 10 to 80 feet of water. Sometimes the fish are caught from shore or by kayak fishermen in very shallow water. Slow trolling and drift fishing is the preferred method of bait presentation.

This is an unusual fish in that one eye has to migrate around from one side to the other as it grows from an upright fry or baby fish into an adult fish that lies on its side. The adult has two eyes on the up-side as it lies on the bottom. Most flatfish are generally either right-eyed or left-eyed, but the California halibut is unusual in having a roughly even number of each type. Like other flatfish, the halibut hides under sand or loose gravel and blends into the bottom.

Sportfishing[edit]

The halibut is loved as a sport fishing target species and prized by fishermen of the southern California coastline. It has been taken frequently from shore by surf fishermen. It is sometimes caught from the rocks or near piers. However the most common way to catch them is from a boat with a live bait while drifting across the water. Santa Monica Bay and Los Angeles Harbor are famous for the success of catching them this way.

A fishing event in Santa Monica Bay relies on this love of halibut fishing to produce an annual charity fishing event, The Marina Del Rey Halibut Derby.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!