Articles on this page are available in 2 other languages: Spanish (2), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

Because its patch of algae serves as home, food, and nest all in one, the pacific gregory damselfish values this tiny territory above all else! It can usually be found around dead coral or rocks that are covered in algae, chasing off fish that try to steal its algae. Male damselfish are even aggressive to members of their own species: when they want to drive rival males from their home, they darken their yellow eyes to grey to show dominance.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Adults inhabit rocky and coral reefs exposed to mild to moderate surge (Ref. 9710). Benthopelagic (Ref. 58302). They occur solitary among boulders (Ref. 48636). Territorial in areas where filamentous algae cover rocks and dead coral (Ref. 9710). Monogamous (Ref. 52884). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The pacific gregory damselfish is a sort of undersea farmer, tending to its patch of algae. It prefers thin algae that look like threads or really thin spaghetti. When it doesn’t like other types of algae that grow in its patch, such as calcareous algae (algae that has hard stems made of calcium), it weeds them out, as any good farmer would.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to eastern Oceania, including the Hawaiian and Easter islands, north to the Ryukyu Islands, south to Australia and the Kermadec Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: Coral Sea, New Caledonia, Lord Howe Island, Norfolk Island and Kermadec Islands east to Hawaiian Islands and Easter Island, north to Ryukyu Islands and Wake Atoll, south to Tonga and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 15 - 17; Analspines: 2; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

16.5 cm NG (male/unsexed; (Ref. 89467))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits shallow seaward reefs exposed to mild to moderate surge (Ref. 1602). At Lord Howe and Easter Islands it is know to occur from shallow surge pools down to at least 30 m. Feeds on filamentous algae.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Variable body color, pale gray and various shades of brown from tan to nearly blackish (geographic varieties); each scale with blackish streak near margin appearing as narrow transverse bands. Usually bright yellow iris (except the Indonesian Pacific form); a bluish band across preorbital bone from lower front corner of eye to mouth; pale gray to whitish lips. Spinous part of dorsal fin with translucent submarginal band; median and pelvic fins gray to brown, except the Indian Ocean variety; pectoral fins nearly translucent to dusky brown, black spot at base of uppermost ray. Juveniles usually have blue-bordered dorsal and anal fins (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Cotype for Stegastes fasciolatus
Catalog Number: USNM 50671
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Stegastes fasciolatus
Catalog Number: USNM 126552
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Stegastes fasciolatus
Catalog Number: USNM 49700
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): O. Jenkins
Year Collected: 1899
Locality: Hawaiian Islands, Hawaii, United States, Pacific
  • Holotype: Jenkins, O. P. 1901. Bulletin of the United States Fish Commission. 19 (for 1899): 391.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 30 m (Ref. 9710), usually 1 - 5 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 133 specimens in 1 taxon.
Water temperature and chemistry ranges based on 109 samples.

Environmental ranges
  Depth range (m): 0.5 - 35
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.006 - 0.617
  Salinity (PPS): 32.768 - 36.142
  Oxygen (ml/l): 4.441 - 5.079
  Phosphate (umol/l): 0.092 - 0.301
  Silicate (umol/l): 0.897 - 6.035

Graphical representation

Depth range (m): 0.5 - 35

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.006 - 0.617

Salinity (PPS): 32.768 - 36.142

Oxygen (ml/l): 4.441 - 5.079

Phosphate (umol/l): 0.092 - 0.301

Silicate (umol/l): 0.897 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). At Lord Howe Is. & Easter Is., depth distribution is widespread, occurring in rocky habitats from shallow surge pools to at least 30 m.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

Thin (filamentous) algae, an important part of turf algae, is what pacific gregory damselfish eat. So the pacific gregory damselfish will often be found munching on turf algae. It also eats tiny animals called zooplankton that live in its algae garden. Because it eats both plants and animals, it is an omnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Stegastes fasciolatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Stegastes fasciolatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCTTTAAGCCTCCTAATTCGGGCAGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAGATTTATAATGTTATTGTTACAGCACACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGGTTTGGAAACTGGCTCATTCCCCTCATGATCGGAGCCCCCGACATGGCCTTCCCCCGTATGAACAATATGAGCTTCTGACTCCTCCCCCCTTCGTTTCTTCTCCTACTCGCCTCCTCAGGTGTTGAAGCAGGTGCAGGGACAGGATGAACTGTCTACCCCCCACTATCTGGCAACCTAGCCCACGCGGGAGCTTCCGTTGATTTAACCATTTTCTCCCTCCACTTAGCAGGTATTTCTTCTATTCTAGGAGCTATCAACTTCATTACCACAATTATTAATATAAAACCACCCGCTATCTCCCAGTACCAAACCCCTCTCTTCGTATGGGCAGTACTTATTACTGCTGTTCTACTTCTGCTGTCTCTCCCAGTGTTGGCCGCCGGTATTACTATACTTCTGACCGATCGAAACCTAAATACCACTTTCTTTGACCCCGCAGGTGGAGGAGACCCCATTCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Western Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

In the reef community, pacific gregory damselfish act as protectors of algae and coral, driving away many fish that would normally feast on them. So it makes sense that, where there are many damselfish—such as the waters off the coast of Hawaii and Australia—there are also healthy communities of algae and coral. Because of its unusual importance to the reef ecosystem, the pacific gregory damselfish is called a keystone species. If too many damselfish are fished out of the sea, the delicate balance they maintain will be thrown off!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Stegastes fasciolatus

Stegastes fasciolatus, commonly called the Pacific gregory, is a damselfish of the family Pomacentridae. It is native to the tropical western Indo-Pacific. It feeds on filamentous algae.

Distribution and habitat[edit]

Stegastes fasciolatus is native to the western Indo-Pacific region. Its range extends from East Africa to Australia and the Kermadec Islands including Hawaii, Easter Island and the Ryukyu Islands.[2] where it is found on shallow seaward reefs particularly in areas with mild to moderate water movement. At Lord Howe Island and Easter Island it occurs from shallow surge pools down to depths of at least 30 m (98 ft).[1]

References[edit]

  1. ^ a b Bailly, Nicolas (2013). "Stegastes fasciolatus (Ogilby, 1889)". World Register of Marine Species. Retrieved 2014-01-07. 
  2. ^ "Stegastes fasciolatus (Ogilby, 1889): Pacific gregory". FishBase. Retrieved 2014-01-07. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!