Overview

Comprehensive Description

Biology

Juveniles live in estuaries (Ref. 33616) while adults occur in estuaries and on inshore and offshore rocky reefs and seagrass beds (Ref. 9563). Found either in large schools, in pairs or as solitary individuals (Ref. 33616). Neither anterolateral glandular groove nor venom gland is present (Ref. 57406).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Enoplosus armatus is found from Indonesia to Southern Australia (Robins 1991).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Endemic to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The body of Enoplosus armatus is deep and compressed, approximately 230 mm in length. The body is silver with black vertical lines of varying width. There are two separate dorsal fins. The middle spines and the anterior rays of the dorsal fins are much larger than the remaining spines and rays. In total, E. armatus has 9 dorsal spines and 14-15 dorsal rays (Fishbase 2000). The dorsal spines are poisonous to humans (Robins 1991). There are 2 sharp spines on the lower angle of the preoperculum. The iris of the eye is bright yellow (Scott 1962).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 9; Dorsal soft rays (total): 14 - 15; Analspines: 3; Analsoft rays: 14 - 15; Vertebrae: 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 7300))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults are silver to brown with black vertical stripes (Ref. 33616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Juvenile Enoplosus armatus live in sea grass beds. As they mature, they migrate to coastal waters. They are mainly found in rocky reefs and wharves (Marshall 1964).

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 58 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 0.75 - 94.5
  Temperature range (°C): 14.137 - 25.344
  Nitrate (umol/L): 0.150 - 1.227
  Salinity (PPS): 35.057 - 36.070
  Oxygen (ml/l): 4.701 - 5.456
  Phosphate (umol/l): 0.134 - 0.295
  Silicate (umol/l): 1.128 - 3.763

Graphical representation

Depth range (m): 0.75 - 94.5

Temperature range (°C): 14.137 - 25.344

Nitrate (umol/L): 0.150 - 1.227

Salinity (PPS): 35.057 - 36.070

Oxygen (ml/l): 4.701 - 5.456

Phosphate (umol/l): 0.134 - 0.295

Silicate (umol/l): 1.128 - 3.763
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 90m.
Recorded at 90 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range ? - 90 m (Ref. 9563)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Enoplosus armatus is a carnivorous species. Not much is known about their general feeding habits. They have been seen eating small crustaceans (Stead 1906).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Juveniles live in estuaries (Ref. 33616) while adults occur in estuaries and on inshore and offshore rocky reefs and seagrass beds (Ref. 9563).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

The reproduction of Enoplosus armatus has not been well studied. They spawn in June, July, and August (Fishbase 2000). At this time they leave their schools and form closely associated pairs. They produce pelagic eggs. These are eggs that are lighter than water and therefore float and drift in the water column (Thresher 1984).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Enoplosus armatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGCA574-10|NC_013181|Enoplosus armatus| ACACGTTGATTTTTCTCGACTAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGTATAGTAGGCACGGCCCTA---AGCTTGCTCATTCGAGCAGAGCTAAGCCAACCAGGCGCTCTCCTTGGGGAC---GACCAGATTTATAACGTCATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGCTTTGGAAACTGACTTATTCCCCTAATG---ATCGGGGCCCCCGACATAGCATTTCCTCGAATAAATAACATGAGCTTTTGACTTCTTCCTCCATCTTTCCTTCTTCTCCTGGCTTCTTCCGGGGTTGAAGCTGGTGCCGGAACGGGCTGAACCGTCTACCCTCCTCTATCGGGCAATTTAGCTCATGCTGGAGCATCCGTTGATCTA---ACTATCTTTTCCCTTCATTTAGCAGGAATTTCCTCAATTTTAGGGGCAATTAACTTTATTACAACAATTATTAACATGAAACCACCTGCCATCTCCCAGTATCAAACTCCCCTATTCGTTTGAGCTGTCCTAATTACTGCAGTCCTACTCCTCCTTTCTCTTCCAGTCCTTGCTGCG---GGCATTACAATGCTGCTTACAGATCGAAACCTAAATACAACATTCTTTGACCCCGCAGGTGGTGGTGATCCCATCCTTTACCAACACCTGTTCTGATTTTTTGGACATCCAGAAGTCTATATTTTAATTTTACCGGGCTTCGGAATAATCTCCCACATCGTAGCTTACTACTCTGGCAAAAAA---GAACCTTTTGGTTATATGGGTATGGTCTGAGCCATGATAGCAATTGGCCTTTTAGGATTCATTGTTTGAGCCCATCACATATTTACAGTAGGTATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Enoplosus armatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 8
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Enoplosus armatus is not currently threatened by humans.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Enoplosus armatus has no known negative financial effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Enoplosus armatus has a small financial value as a food source. The value of E. armatus in the aquarium market is small but growing (Animal World 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: minor commercial; aquarium: commercial; price category: An attractive aquarium fish.; price reliability: not marketed/unknown
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Enoplosus armatus

Enoplosus armatus, the Old Wife (plural: Old Wives), is a species of perciform fish natively endemic to the temperate coastal waters of Australia.[1] It is the only modern species in the family Enoplosidae.

Old wives are commonly found in pairs or large schools.[2]

It has a deep and compressed body and concave forehead. These features are characteristic of typical butterflyfishes.[3] However, the oldwife is easily distinguished by its silver-and-black zebra-striped coloration, and by its two prominent dorsal fins. The second dorsal fin is very long, and sickle-shaped. The fish grows up to 50 cm long.

The second dorsal fin is longer and sickle shaped.

Its dorsal fins have bony spines. These have no obvious venom groove nor gland.[4] Nonetheless the spines are widely considered to inflict a painful venom.[1]

The name "Old Wife" refers to the sound it makes when caught, caused by it grinding its teeth.[5][1] Other vernacular names have included "Bastard Dory", "Zebra-fish" (also used for Girella zebra), and "Double Scalare".[6] It has a similar range and appearance to the Moonlighter (Tilodon sexfasciatus).[7]

History

50 million year old fossil Enoplosus pygopterus with preservation of zebra markings.[8]

The Old Wife was originally classified in the genus chaetodon (with the typical butterfly-fishes) but it is now classified as the sole modern species of its own family Enoplosidae and genus Enoplosus. Some fossils have also been added to the Enoplosus genus.

"The Pungent Chaetodon" illustration accompanying the original 1790 description of chaetodon (now enoplosus) armatus in John White's voyage journal.[9] Attributed to convict artist Thomas Watling.

The first description of the species, one of the earliest for any Australian fish, was in 1790 by John White in his Journal of a voyage to New South Wales.[5] White originally named it the Long-Spined Chaetodon (Chætodon armatus) and described it as follows:[9]

Whitish Chaetodon, with seven black stripes on the body. Six spines on the dorsal fin, the third very long. This appears to be a new and very elegant species of the genus Chaetodon. The total length of the specimen was not more than four inches. The colour a silvery white, darker, and of a bluish tinge on the back; the transverse fasciae, or bands, of a deep black; the fins and tail of a pale brown. The third ray or spine of the first dorsal fin is much longer than the rest.

The species was reclassified by Lacépède into its own genus (named from "weapon" in Greek to again reflect the long spines), and was moved by Cuvier from Chaetodontidae into its own separate family within Percoidei.[10]

In 1836, Agassiz identified closely related fossils at Monte Bolca (an important fossil site in Europe) as Enoplosus pygopterus (named for its smaller fins).[10][11] Exceptionally well-preserved fossils show that the basic body plan and even the zebra pattern of colouring have not changed significantly over the last 50 million years.[8]

References

  1. ^ a b c Old Wife, The Australian Museum.
  2. ^ Old Wife, Reef Watch Victoria. (Divers' monitoring and conservation project.)
  3. ^ "Most [Butterflyfish, Angelfish and Surgeonfish] have thin, oval or disk shaped bodies. They typically have bright colors and patterns. Butterflyfish are usually round, small and have concave foreheads. They often have long snouts for feeding from crevices." AWARE-Fish Identification, Adventures in Diving Manual, PADI (2010).
  4. ^ Smith and Wheeler, Venom Evolution Widespread in Fishes, Journal of Heredity v.97 i.3 pp.206-217 (2006).
  5. ^ a b Morrison, Sue; Storrie, Ann (1999). Wonders of Western Waters. Como, Western Australia: Department of Conservation and Land Management. pp. 119. ISBN 0-7309-6894-4. 
  6. ^ Agustin, Liza Q., et alii (13.07.07). "Common Names of Enoplosus armatus". Common name summary. FishBase. http://www.fishbase.org/comnames/CommonNamesList.php?ID=4341&GenusName=Enoplosus&SpeciesName=armatus&StockCode=4527. Retrieved 2009-01-03. 
  7. ^ Moonlighter, Dive Around. (Guide to marine life.)
  8. ^ a b The 'Lost Language' of Fishes (with captioned images), Australian Research Council's Centre of Excellence for Coral Reef Studies. Colouring patterns demonstrated to have been preserved in fish (especially Old Wives) for at least 50mya.
  9. ^ a b White, J. 1790, Journal of a voyage to New South Wales with sixty-five plates of non descript animals, birds, lizards, serpents, curious cones of trees and other natural productions.: Pl. 39. [transcription at Gutenberg
  10. ^ a b L. Agassiz. 1836. Recherches Sur Les Poissons Fossiles. Tome IV (livr. 6). Imprimerie de Petitpierre, Neuchatel 53-108 [1]
  11. ^ Pygon+pteron. George Roberts, An etymological and explanatory dictionary of the terms and language of geology designed for the early student, and those who have not made progress in the science, free ebook.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!