Overview

Comprehensive Description

Biology

Adults inhabit coastal coral reefs with moderate wave action (Ref. 9710). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: known only from Mauritius and Reunion.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Indian Ocean: Réunion, Mauritius and Rodrigues (Mascarenes endemic).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13; Analspines: 2; Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 160 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

16.0 cm SL (male/unsexed; (Ref. 7247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits coastal coral reefs.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Abudefduf margariteus
Catalog Number: USNM 153569
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): N. Pike
Year Collected: 1871
Locality: Mauritius, Mascarene Islands, Indian
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 2 - 8 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 7 - 7
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 8m.
From 2 to 8 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coastal coral reefs with moderate wave action (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abudefduf margariteus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTGGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCCCTAAGCCTTCTTATTCGAGCAGAACTTAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAACGTAATTGTTACGGCACATGCCTTTGTAATAATTTTCTTTATAGTAATNCCAATTATGATCGGAGGGTTTGGAAACTGATTAATCCCCCTCATGATCGGGGCCCCCGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTTCCTCCATCATTCTTACTTCTTCTTGCCTCTTCCGGAGTTGAAGCAGGTGCAGGAACAGGCTGAACTGTCTACCCACCACTATCGGGCAACTTAGCTCACGCAGGAGCCTCTGTTGACTTAACTATTTTTTCCCTTCATCTAGCAGGTGTATCCTCAATTTTAGGAGCCATCAATTTTATTACTACCATTATTAACATGAAACCTCCTGCTATTTCTCAATATCAGACCCCCCTTTTCGTATGAGCCGTACTTATTACGGCTGTGCTTCTGCTTCTTTCCCTCCCTGTTTTAGCCGCCGGAATTACAATACTTCTAACCGACCGAAACTTAAACACCACATTCTTCGACCCAGCTGGGGGAGGAGATCCCATTCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Abudefduf margariteus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!