Overview

Comprehensive Description

Biology

Common offshore (Ref. 2850). Viviparous, with planktonic larvae and pelagic juveniles (Ref. 36715). Trawled on soft bottom and when caught scales usually rub off, leaving white pockets bordered by red; also caught in sablefish traps (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Pacific: Amphitrite Point in Vancouver Island, Canada to Cedros Island, Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 5 - 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 410 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

41.0 cm TL (male/unsexed; (Ref. 27437)); max. reported age: 75 years (Ref. 55644)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head spines strong - nasal, preocular, supraocular, postocular, tympanic, parietal and nuchal spines present, coronals usually absent (Ref. 27437). Small lobes projecting from anterior part of upper jaw (Ref. 27437). Second anal fin spine long (Ref. 27437). Rose-red to pink dorsally, silvery on sides and ventrally (Ref. 27437).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Cotype for Sebastichthys aurora
Catalog Number: USNM 48240
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1889
Locality: Off Southern California., California, United States, Pacific
Depth (m): 486 to 486
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Sebastichthys aurora
Catalog Number: USNM 48239
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1889
Locality: Off Southern California., California, United States, Pacific
Depth (m): 486 to 486
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 124 - 769 m (Ref. 27437), usually 366 - 550 m (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 125 - 488
  Temperature range (°C): 4.921 - 8.165
  Nitrate (umol/L): 27.466 - 40.338
  Salinity (PPS): 33.609 - 34.301
  Oxygen (ml/l): 0.321 - 3.282
  Phosphate (umol/l): 2.261 - 3.216
  Silicate (umol/l): 40.325 - 81.249

Graphical representation

Depth range (m): 125 - 488

Temperature range (°C): 4.921 - 8.165

Nitrate (umol/L): 27.466 - 40.338

Salinity (PPS): 33.609 - 34.301

Oxygen (ml/l): 0.321 - 3.282

Phosphate (umol/l): 2.261 - 3.216

Silicate (umol/l): 40.325 - 81.249
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 124 - 769m.
From 124 to 769 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous (Ref. 36715, 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes aurora

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTACTACTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTTGGGGCAATCAATTTTATCACCACAATTGTTAACATGAAGCCCCCGGCCATCTCTCAATACCAGACACCCCTATTTGTGTGAGCTCTCCTAATTACGGCTGTTCTTCTCCTTCTCTCCCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTTTTTGGGCACCCGGAGGTATATATTCTCATTCTGCCTGGCTTTGGTATGATCTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATAGGCATAGTGTGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCCCATCACATATTTACAGTTGGCATAGACGTAGACACGCGTGCTTATTTTACATCTGCCACAATAATCATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCAGGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTATTCTGGCCAATTCATCTCTAGATATTGTACTCCACGACACCTACTATGTAGTAGCCCACTTCCACTACGTACTATCTATGGGGGCCGTATTGCCATATCGCCGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes aurora

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!