Overview

Comprehensive Description

Biology

Usually on sandy or gravelly bottoms from shoal waters to 90 m depth (Ref. 7251), with temperature range of 1.2-21°C. Benthic (Ref. 5951). Mostly inactive during daylight, but active under dark conditions (Ref. 10807). Feeds on bottom-dwelling organisms such as crabs, shrimps, polychaetes, sea squirts, mollusks, squids and bony fishes (Ref. 27549). Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 4.6-6.3 cm long and 2.7-4.8 cm wide, about 10-35 eggs are laid annually (Ref. 41250). Possesses an electric organ located in the tail region (Ref. 10807). Electric organ discharge (EOD) activity is intermittent (Ref. 10011) and seemed more frequent during dark periods (Ref. 10808). The individual EOD of this species is monophasic, head-negative, and lasts 70 ms (Ref. 10011).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Usually on sandy or gravelly bottoms from shoal waters to 90 m depth (Ref. 7251), with temperature range of 1.2-21°C. Benthic (Ref. 5951). Mostly inactive during daylight, but active under dark conditions (Ref. 10807). Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 4.6-6.3 cm long and 2.7-4.8 cm wide, about 10-35 eggs are laid annually (Ref. 41250). Possesses an electric organ located in the tail region (Ref. 10807). Electric organ discharge (EOD) activity is intermittent (Ref. 10011) and seemed more frequent during dark periods (Ref. 10808). The individual EOD of this species is monophasic, head-negative, and lasts 70 ms (Ref. 10011).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Northwest Atlantic: occasionally from the Grand Banks and northeast Newfoundland, more common on the Scotian Shelf in Canada, south to Cape Hatteras, North Carolina, USA (Bigelow and Schroeder 1953, Richards et al. 1963, McEachran and Musick 1977, Michalopoulos 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

southeastern Newfoundland to North Carolina
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: southern Gulf of St. Lawrence and Nova Scotia in Canada to North Carolina, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Gulf of St. Lawrence and northern Nova Scotia to Virginia, USA; in coastal waters and on the shoals of the offshore banks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 530 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

54.0 cm TL (male/unsexed; (Ref. 1126))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 54.0 cm TL.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat ranges from shallow shoal waters to 90 m depth, usually on sandy or gravelly substrates. This species reaches a maximum size of 60 cm total length (TL) (Johnson 1979). Males and females mature at 35-50 cm TL and size at birth is 9.3-10.2 cm TL (McEachran 2002, Richards et al. 1963). Females produce 28-33 eggs per year after a gestation period of 9-12 months (Richards et al. 1963, Johnson 1979).

Little Skates make no extensive migrations, although where it occurs inshore the species moves onshore and offshore with seasonal temperature changes (Collette and Klein-MacPhee 2002). Common prey items include hermit and other crabs, shrimps, worms, amphipods, ascidians (sea squirts), bivalve mollusks, squid, small fishes, and even some copepods (Collette and Klein-MacPhee 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9081 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7293 samples.

Environmental ranges
  Depth range (m): 4.4 - 875
  Temperature range (°C): 1.894 - 20.754
  Nitrate (umol/L): 1.186 - 25.613
  Salinity (PPS): 31.035 - 36.286
  Oxygen (ml/l): 3.415 - 7.523
  Phosphate (umol/l): 0.323 - 1.564
  Silicate (umol/l): 1.599 - 17.288

Graphical representation

Depth range (m): 4.4 - 875

Temperature range (°C): 1.894 - 20.754

Nitrate (umol/L): 1.186 - 25.613

Salinity (PPS): 31.035 - 36.286

Oxygen (ml/l): 3.415 - 7.523

Phosphate (umol/l): 0.323 - 1.564

Silicate (umol/l): 1.599 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on sandy or gravelly bottoms, prefer shallow waters but have been found up to 90m.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 0 - 329 m (Ref. 5951)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9081 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7293 samples.

Environmental ranges
  Depth range (m): 4.4 - 875
  Temperature range (°C): 1.894 - 20.754
  Nitrate (umol/L): 1.186 - 25.613
  Salinity (PPS): 31.035 - 36.286
  Oxygen (ml/l): 3.415 - 7.523
  Phosphate (umol/l): 0.323 - 1.564
  Silicate (umol/l): 1.599 - 17.288

Graphical representation

Depth range (m): 4.4 - 875

Temperature range (°C): 1.894 - 20.754

Nitrate (umol/L): 1.186 - 25.613

Salinity (PPS): 31.035 - 36.286

Oxygen (ml/l): 3.415 - 7.523

Phosphate (umol/l): 0.323 - 1.564

Silicate (umol/l): 1.599 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal marine; depth range 0 - 90 m. Usually on sand or gravel bottoms from shoal waters to 90 m depth. Nocturnal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Prefers water with lower temperature, with a move inshore in winter and offshore into deeper water in summer. Decapod crustaceans and amphipods serve as important foods; also feeds on polychaetes, isopods, molluscs, fishes. Parasites of the species include: 3 protozoans, 2 myxosporidians, nematode and 2 copepods (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Decapod crustaceans and to a lesser extent on amphipods, polychaetes, squids and fishes. The little skate has an electric organ in the tail region that is active intermittently and more frequently when dark.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Leucoraja erinacea (Little Skate) is prey of:
Mustelus canis
Squalus acanthias
Lophius americanus
Pomatomus saltatrix
Chondrichthyes

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Leucoraja erinacea (Little Skate) preys on:
Ctenophora
other worms
Chaetognatha
Anthozoa
Crangon
Mysidae
Pandalidae
Decapoda
Gammaridae
Hyperiidae
Caprellidae
Isopoda
Cumacea
Stomatopoda
Cancer
Brachyura
Hydrozoa
Polychaeta
Echinodermata
Ophiuroidea
Holothuroidea
Ostreoida
Bivalvia
Echinoidea
Ammodytes marinus
Clupea harengus
Scomber
Peprilus triacanthus
Actinonaias ellipsiformis
Tridonta arctica
Pollachius pollachius
Merluccius bilinearis
Urophycis regia
Urophycis tenuis
Urophycis chuss
Gadidae
Melanogrammus aeglefinus
Hemitripterus americanus
Myoxocephalus octodecemspinosus
Leucoraja ocellata
Amblyraja radiata
Macrozoarces americanus
Brosme brosme
Anarhichas
Sebastes marinus
Pleuronectes ferrugineus
Scophthalmus aquosus
Paralichthys dentatus
Glyptocephalus cynoglossus
Hippoglossina oblonga
Pleuronectes americanus
Hippoglossoides platessoides
Hippoglossus hippoglossus

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Especially crustaceans and amphipods, though polychaetes, molluscs and fishes are also consumed.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In the laboratory, eggs laid in May - July hatch after 5 to 6 months. Incubation periods are likely to be longer in nature when temperatures are lower.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leucoraja erinacea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTAATCGCTGATTATTCTCTACTAATCACAAAGATATCGGCACCCTCTACCTAATCTTTGGTGCCTGAGCAGGTATAGTCGGAACTGGCTTAAGTCTTTTAATTCGAGCAGAATTGAGCCAGCCCGGATCACTTCTAGGTGATGATCAGATTTATAATGTCCTTGTTACAGCCCATGCCTTTGTAATAATCTTTTTTATGGTCATACCAATTATAATCGGAGGGTTCGGCAATTGACTTGTCCCTTTAATGATTGGCTCTCCAGACATAGCCTTCCCACGCATAAATAATATGAGCTTTTGACTTTTACCACCCTCATTTCTTCTTCTCCTAGCCTCCGCTGGAGTTGAAGCCGGGGCGGGAACAGGTTGAACTGTCTACCCCCCTCTAGCAGGCAATCTAGCCCACGCGGGGGCCTCCGTAGACTTAACAATTTTCTCTCTCCATTTAGCAGGGATTTCTTCCATCCTGGCCTCCATTAACTTCATCACCACAATTATTAACATAAAACCCCCCGCAATCTCTCAATACCAAACACCTTTATTCGTATGATCGATCCTTGTTACAACTGTCTTACTTCTTATGGCCCTCCCAGTTCTAGCAGCTGGCATTACCATACTTCTCACAGATCGTAACCTCAATACAACTTTCTTTGACCCAGCAGGAGGAGGGGACCCTATTCTTTACCAACACCTATTCTGATTTTTTGGTCACCCTGAAGTATATATTTTAATTTTACCAGGATTTGGAATAATCTCCCATGTAGTTGCTTATTACTCAGGTAAAAAAGAACCATTCGGCTATATAGGTATAGTCTGAGCAATAATAGCCATCGGCCTTTTAGGATTTATCGTCTGAGCACATCACATATTCACAGTGGGAATAGATGTTGACACACGAGCATACTTCACATCAGCCACAATAATTATTGCCATTCCAACAGGAGTTAAAGTCTTTAGTTGACTAGCCACCCTCCACGGCGGCTCCATTAAATGAGAAACACCACTACTTTGAGCATTAGGCTTCATCTTCCTTTTTACAGTTGGAGGACTGACAGGAATCGTCTTAGCCAATTCTTCACTTGACATCGTTCTCCATGATACTTACTATGTTGTAGCCCATTTCCATTATGTTCTCTCAATGGGGGCAGTATTTGCTATTATAGCAGGCTTTGTCCACTGATTCCCATTATTTACAGGTTATACACTTCACTCCACATGAGCAAAAATTCAATTTTCAATTATATTTATCGGAGTAAACCTAACCTTCTTCCCCCAACATTTTCTAGGATTAGCAGGCATACCACGACGCTACTCAGATTATCCAGATGCTTATACCCTCTGAAATGTGGTATCCTCTATTGGATCCTTAATCTCACTAGTAGCCGTTATCATTTTATTATTTATTATTTGAGAAGCATTTGCCTCAAAACGTGAAGTCTTATCCATCGAACTCTCTAATACTAATGTGGAGTGACTTCATGGTTGCCCTCCCCCATACCACACCTACGAAGAGCCAGCTTTCGTTCAAGTCCAACAGCCCGCTTATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leucoraja erinacea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 73
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Biodiversity Institute of Ontario
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Sulikowski, J., Kulka, D.W. & Gedamke, T.

Reviewer/s
Dulvy, N.K. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
The Little Skate (Leucoraja erinacea) is considered a shallow water species and occurs to depths of 90 m. It has a relatively narrow distribution, found only in the northwest Atlantic from Grand Banks, Canada to Cape Hatteras, North Carolina, USA, and reaches its highest concentrations in USA waters. It is relatively rare to the north in Canadian waters, with very few records north of the Scotian Shelf. In the continental USA, this species is commercially targeted for lobster bait and is landed as bycatch. Currently there is no specific management plan in place for the little skate in the USA but there is a framework that could implement restrictions to the fishery if biomass levels fall below threshold levels. Biomass estimates for Little Skate were increasing until recently. However, recent trawl surveys (2006) conducted by the National Marine Fisheries surface suggest that the Little Skate is near the overfishing threshold (18.7 vs. 20%) and will likely be above the threshold as of 2007. It is also near the minimum biomass threshold (3.32 vs. 3.27 kg/tow) and may become overfished. The lack of information on sexual maturity coupled with the apparent recent declines in biomass warrant a precautionary assessment of Near Threatened (close to meeting VU A4bd). Population trends should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The Little Skate (Leucoraja erinacea) is distributed from Nova Scotia, Canada to Cape Hatteras, USA and is one of the dominant members of the demersal fish community in the USA portion of the Northwest Atlantic (Bigelow and Schroeder 1953, Richards et al. 1963, McEachran and Musick 1977, Michalopoulos 1990). Its center of abundance appears to be the northern section of the mid-Atlantic Bight and on Georges Bank, where it is found year-round (McEachran and Musick 1977). In fact, survey estimates since 1997 have been and continue to be the highest on record for little skates. The 1999-2001 three-year average of 8.47 kg/tow is well above the proposed biomass threshold of 3.27 kg/tow and even above the proposed biomass target. Due to the overall increases in little skate biomass over the last 20 years which was at its highest level (NEFSC 2000). However, recent trawl surveys (2006) conducted by the National Marine Fisheries surface suggest that the little skate is near the overfishing threshold (18.7 vs. 20%) and will likely be above the threshold as of 2007. It is also near the minimum biomass threshold (3.32 vs. 3.27 kg/tow) and may become overfished (NEFMC 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The principal threat to Little Skate is over-exploitation from commercial fishing and bycatch. Otter trawls are the primary fishing method associated with direct and indirect Little Skate catch. Recreational and foreign landings are currently insignificant, at <1% of the total USA fishery landings (Packer et al. 2003).

In US waters, a directed fishery exists for little skates in Rhode Island for utilization primarily as lobster bait. However, vessels from other ports (New Bedford, and Martha's Vineyard, Massachusetts (MA); Block Island, Long Island, and, to a lesser degree, Chatham and Provincetown, MA) have been identified as participating in the directed skate bait fishery to some extent (NEFMC 2001). The time series of skate landings shows a significant increase in landings in the 1990s (6,700 mt in 1989, about 11,400 mt annually from 1990 to present). Fishermen and state fisheries managers attribute the increase in skate landings in 1990 to better reporting and documentation, rather than a significant expansion of the skate fishery. Total recreational landings for little skate varied between <1,000 and 56,000 fish, equivalent to <1-15 mt, during 1981 to 1998 (Packer et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently there is no specific management plan in place for the little skate. In the USA, there is a framework that could implement restrictions to the fishery if biomass levels fall below threshold levels (NEFMC 2003).

Recommendations for future conservation action: Enforce U.S. species-specific landings reporting requirements and increase scientific research and government sea sampling attention to skates; begin developing estimates for target and limit reference points; reduce discard mortality by encouraging and/or mandating more careful handling and discard techniques.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Little skate

The little skate, Leucoraja erinacea, is a species of skate in the family Rajidae, found from Nova Scotia to North Carolina on sand or gravel habitats.[1] They are one of the dominant members of the demersal fish community in the northwestern Atlantic. This species is of minimal commercial importance and is mostly used as bait for lobster traps, though its wings are also marketed for food.[2] It is also important as a model organism for biological and medical research.[3]

Distribution and habitat[edit]

This skate is native to the western Atlantic Ocean, from Nova Scotia, Canada, to Cape Hatteras, North Carolina, USA. They are most abundant in the northern Mid-Atlantic Bight and the Georges Bank. Little skates prefer sandy or gravelly habitats from the shore to a depth of 90 meters (300 ft), though they have been caught as deep as 329 m (1,079 ft). They can tolerate temperatures of 1.2–21 °C (34.2–69.8 °F) and salinities of 27–33.8 ppt (though the optimum is 29–33 ppt). They do not undertake long migrations, but at the inshore parts of the species' range individuals move into shallower water during the summer and deeper water during the fall and winter. At the southern extent of the range, many also move north and south with changing temperatures.[2][4]

Description[edit]

Dorsal view of a little skate

The little skate has a rounded pectoral fin disk 1.2 times as wide as long, and a blunt snout with a central tip. The jaws contain 38–66 series of round teeth on plates, adapted for grinding food.[4] The pelvic fins are divided into two parts, with the forward lobe modified into a leg-like structure.[5] The tail is longer than the disk in juveniles and shorter in adults. Two small, closely spaced dorsal fins are located near the tip of the tail. Adults have small dermal denticles and usually no midline thorns, though there are strong spines on the dorsal surfaces of the head, shoulders, and tail. Males tend to have fewer spines than females.[4]

The coloration of the little skate ranges from grayish to uniform or variable shades of brown above, becoming lighter towards the edges of the disk, and white or gray below. Most individuals have small, round, dark spots on the back. The tail has irregular dusky blotches or a dark gray ventral surface. The little skate may be confused with unspotted individuals of the winter skate (Leucoraja ocellata), which has a similar shape. This species typically measures 41–51 cm (16–20 in) long, but may reach 54 cm (21 in) long.[4] Little skates grow to a larger maximum size in the northern part of their range.[2]

Biology and ecology[edit]

Little skates are more active at night and spend much of the day buried in sediment, usually near specific landscape features such as depressions excavated by other animals.[2] They employ a curious mode of locomotion, dubbed "punting" by the first scientists to document it, to move over the sea floor. The forward lobes of the pelvic fins are modified into leg-like structures called "crura" (singular "crus"), containing three flexible joints and modified skeletal and muscular elements. The little skate pushes off the substrate with both crura and then glides a short distance on its wings while repositioning the crura for the next push. The crura are also used as pivots when the skate needs to turn. It has been speculated that using the pelvic fins in this manner assists in hunting, by reducing water turbulence that might alert the prey or distort the ray's electroreception.[5]

The tail of the little skate contains an electric organ that intermittently generates a weak electric field (the electric organ discharge or EOD). The EOD lasts 70 ms and has a head-negative monophasic waveform.[1] This electric organ is thought to function in communication, and may help potential mates locate one another.[4]

Young and adult little skates are preyed upon by sharks, other skates, teleost fishes (including cod, goosefish, sea ravens, longhorn sculpins, bluefish, and summer flounder), gray seals, androck crabs (Cancer irroratus). Their egg-cases are preyed on by the sea urchin Strongylocentrotus droebachiensis and the whelk Buccinum undatum.[2] Known parasites of the little skate include the protozoans Caliperia brevipes, Haemogregarina delagei, and Trypanosoma rajae, the myxosporeans Chloromyxum leydigi and Leptotheca agilis, the nematode Pseudanisakis tricupola, and the copepods Eudactylina corrugata and Lernaeopodina longimana.[4]

Feeding[edit]

The diet of the little skate consists mostly of decapod crustaceans and amphipods. Polychaete worms are also an important prey item, while other invertebrates (including isopods, bivalves, squid, sea squirts, and copepods) and small benthic fishes (including sand lances, herring, cunners, and cod) are rarely taken. The importance of crustaceans in the skate's diet increases with size. This species shares its benthic habitat with the similar winter skate; the little skate focuses more on epifauna (organisms living atop the substrate) while the winter skate eats more infauna (burrowing organisms).[2] The little skate has an extremely high number of electrosensory ampullae of Lorenzini around its mouth, giving it a high degree of spatial precision when hunting for prey buried in the substrate.[6]

Reproduction[edit]

A dried-up egg case of the little skate, washed up on Long Beach, Long Island, New York, in October 2010

Little skates are oviparous. Mating occurs frequently throughout the year and pregnant females can be found year-round. However, eggs are most common from October to December and from April to May, and least common from August to September and February to March. An average little skate spawns twice a year, in spring and fall, and produces a total of 10–35 eggs annually. Females deposit their egg capsules in pairs on sandy bottoms, in water no more than 27 m (89 ft) deep. The egg cases are amber-colored when first laid but become greenish-brown and leathery. Each roughly rectangular case contains a single fertilized egg and measures 44–63 mm (1.7–2.5 in) long and 30–45 mm (1.2–1.8 in) wide. There are hollow horns at each corner with sticky tendrils to secure the egg case to the substrate; the anterior horns are half as long as the case and curved inward, while the posterior horns are as long as the case and nearly straight.[2]

Eggs raised in captivity hatch in 5–6 months, while those in the wild may take up to 12 months to hatch, depending on temperature. While inside the case, the embryos have a whip-like extension on the tail believed to be used for circulating water. The newborns measure 93–102 mm (3.7–4.0 in) long and are perfectly formed miniatures of the adults. After hatching, the empty egg capsules often wash ashore and are known as "mermaid's purses". Growth is about 10 cm (3.9 in) per year for the first three years, then slows down to 5 cm (2.0 in) per year between the third and fourth years. At adolescence, males become larger than the females, and this difference persists through adulthood. Males mature at 32–43 cm (13–17 in) long and females at 36–45 cm (14–18 in) long. Very few little skates over 5 years old have been found, suggesting a high mortality rate at that age.[2][4]

An unusual little skate specimen found off Fishers Island, New York contained a developed testis, vas deferens, and functional clasper on its left side and an adolescent ovary, shell gland, oviduct, and abortive clasper on its right. This example of hermaphroditism (a bilateral gynandromorph) is one of very few known for elasmobranch fishes.[4]

Human interactions[edit]

Euell Gibbons promoted the consumption of the little skate in his cookbook Stalking the Blue-eyed Scallop (1964), noting that its wings, properly cut, could be treated like scallops.[7] Round cuts from the little skate's wings are marketed as "scallops", though due to their small size their commercial importance is limited. Little skates are also often used to bait traps, especially for lobsters and eels.[4] Skates are typically caught as bycatch in otter trawls; the little skate is not currently considered to be overfished.[2] Along with the spiny dogfish (Squalus acanthias), the little skate is often used as a model organism in biomedical research. A BAC genomic library for the little skate was completed in January 2005.[3]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Leucoraja erinacea" in FishBase. March 2009 version.
  2. ^ a b c d e f g h i Packer, D.B., Zetlin, C.A. and Vitaliano, J.J. (2003). Essential Fish Habitat Source Document: Little Skate, Leucoraja erinacea, Life History and Habitat Characteristics. NOAA Tech Memo NMFS NE 175. Retrieved on March 14, 2009.
  3. ^ a b Barnes, D. (2008). The Skate (Leucoraja erinacea) Genome Project. MDI Biological Laboratory. Retrieved on August 19, 2010.
  4. ^ a b c d e f g h i Kittle, K. Biological Profiles: Little Skate. Florida Museum of Natural History Ichthyology Department. Retrieved on March 14, 2009.
  5. ^ a b Koester, D.M. and Spirito, C.P. (2003). "Punting: An Unusual Mode of Locomotion in the Little Skate, Leucoraja erinacea (Chondrichthyes: Rajidae)". Copeia 2003 (3): 553–561. doi:10.1643/CG-02-153R1. 
  6. ^ Musick, J.A. and McMillan, B. (2003). The Shark Chronicles: A Scientist Tracks the Consummate Predator. Macmillan. ISBN 0-8050-7359-0. 
  7. ^ Davidson, A. (2003). North Atlantic Seafood: A Comprehensive Guide with Recipes (third ed.). Ten Speed Press. ISBN 1-58008-450-8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Raja; McEachran and Dunn (1998) moved this species into the genus Leucoraja.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!