Overview

Comprehensive Description

Biology

Adults are generally found at depths greater than 150 m during the day. Oviparous, with planktonic eggs and larvae (Ref. 35604), which are distributed in the sub-arctic gyre south to about 47°N (Ref. 6848).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Pacific: southeastern Hokkaido, Japan to Navarin Canyon in the Bering Sea and southern British Columbia, Canada. Possibly in Kamchatka (Ref. 6885). Regarded as a subspecies of Leuroglossus stilbius, Gilbert 1890 but Peden (1981) presented evidence for separating the two and Dunn (1983) placed them in the genus Leuroglossus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific from Hokkaido to British Columbia, Okhotsk and Bering seas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 11; Analspines: 0; Analsoft rays: 11 - 14; Vertebrae: 47 - 52
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 6885))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body slender and compressed. Anal fin base short, and almost equal to dorsal fin base. snout pointed. Eye diameter shorter than snout length. Upper jaw shorter than lower jaw. Teeth present on lower jaw, prevomer, palatine, but not on upper jaw. Branchiostegals, 2. Color silvery, dusky on dorsal surface and fins (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 0 - 1800 m (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 3.5 - 870
  Temperature range (°C): 3.273 - 7.390
  Nitrate (umol/L): 8.441 - 44.429
  Salinity (PPS): 32.272 - 34.080
  Oxygen (ml/l): 0.909 - 7.161
  Phosphate (umol/l): 1.065 - 3.072
  Silicate (umol/l): 15.183 - 116.061

Graphical representation

Depth range (m): 3.5 - 870

Temperature range (°C): 3.273 - 7.390

Nitrate (umol/L): 8.441 - 44.429

Salinity (PPS): 32.272 - 34.080

Oxygen (ml/l): 0.909 - 7.161

Phosphate (umol/l): 1.065 - 3.072

Silicate (umol/l): 15.183 - 116.061
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1800m.
Recorded at 1800 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Adults are generally found at depths greater than 150 m during the day.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 35604).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leuroglossus schmidti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTTTACCTCATCTTTGGTGCCTGAGCCGGAATAGTTGGTACGGCCTTAAGCCTCTTAATCCGAGCCGAACTAAGCCAACCGGGAGCCCTTATAGGGGACGACCAAATTTACAACGTTATTGTGACAGCACATGCTTTCGTCATAATCTTTTTTATAGTGATGCCAGTTATAATCGGCGGCTTTGGAAACTGACTAATCCCTCTTATGATCGGAGCCCCCGACATAGCCTTCCCTCGAATAAATAATATGAGCTTCTGGCTTCTTCCTCCCTCATTTCTTCTCCTCCTAGCCTCTTCCGGCGTAGAAGCCGGAGCAGGGACAGGATGAACAGTTTACCCTCCTCTAGCAAGTAACCTTGCCCATGCAGGAGCTTCCGTAGACCTAACTATTTTCTCCCTTCACCTCGCTGGGATTTCCTCAATTCTTGGGGCAATCAATTTCATCACAACTATTATTAACATGAAGCCCCCAGCTATCTCCCAGTACCAGACACCCCTTTTTATCTGAGCTGTCCTTATTACAGCTGTGCTCCTCCTCCTCTCCCTTCCCGTCCTAGCCGCAGGGATTACAATACTACTTACAGACCGAAACCTAAATACCACCTTCTTTGATCCCGCTGGAGGGGGAGACCCCATTCTTTATCAACATCTCTTCTGATTCTTCGGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Leuroglossus schmidti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern smoothtongue

The Northern smoothtongue (Leuroglossus schmidti) is a type of deepwater fish that can grow to a length of 15 centimetres (5.9 in) TL. The fish are native to the east Pacific Ocean from Oregon, USA to the Gulf of California where they are found at depths of 100 to 690 metres (330 to 2,260 ft).[1]

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). "Leuroglossus schmidti" in FishBase. February 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!