Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Shallow coastal to outer reef flats and slopes to 45 m depth (Ref. 48636). Common inhabitant of coral reefs, typically resting at the bases of coral heads (Ref. 9710). Studies indicate that it is haremic and spawns nightly (Ref. 37816). Occasionally in pairs (Ref. 48636). Sometimes solitary (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Maldives (Ref. 2334) to Samoa, north to the Ryukyu Islands, south to the southern Great Barrier Reef and New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 70 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Common inhabitant of coral reefs, typically resting at the bases of coral heads.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Numerous short filaments at the tip of each dorsal spine. Thickened and elongate lower pectoral rays.Description: Characterized by white color with reddish brown saddles tapered ventrally; rear half of body with vertical rows of red-brown blotches; under eye with pair of reddish bars; dorsal and caudal fin spotted; presence of palatine teeth; coarsely serrate posterior margin of preopercle; greatest depth of body 2.9-3.4 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Cirrhitichthys falco
Catalog Number: USNM 195954
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1937
Locality: Philippines, Mindanao, Gulf of Davao, Mindanao, Philippines, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Cirrhitichthys falco
Catalog Number: USNM 195944
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Tinker
Year Collected: 1950
Locality: Hawaii; Oahu, Pearl Harbor, From a Drydock Hauled Up 1 Yr Ago From Guam, Marianas., Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype: Randall, J. E. 1963. Proceedings of the United States National Museum. 114 (3472): 432, fig. 27.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Cirrhitichthys falco
Catalog Number: USNM 195943
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Tinker
Year Collected: 1950
Locality: Hawaii; Oahu, Pearl Harbor, From a Drydock Hauled Up 1 Yr Ago From Guam, Marianas., Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Holotype: Randall, J. E. 1963. Proceedings of the United States National Museum. 114 (3472): 432, fig. 27.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 4 - 46 m (Ref. 9710), usually 10 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0.3 - 73
  Temperature range (°C): 24.353 - 29.266
  Nitrate (umol/L): 0.016 - 3.456
  Salinity (PPS): 34.336 - 35.481
  Oxygen (ml/l): 4.138 - 4.814
  Phosphate (umol/l): 0.070 - 0.391
  Silicate (umol/l): 0.803 - 4.989

Graphical representation

Depth range (m): 0.3 - 73

Temperature range (°C): 24.353 - 29.266

Nitrate (umol/L): 0.016 - 3.456

Salinity (PPS): 34.336 - 35.481

Oxygen (ml/l): 4.138 - 4.814

Phosphate (umol/l): 0.070 - 0.391

Silicate (umol/l): 0.803 - 4.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 46m.
From 4 to 46 meters.

Habitat: reef-associated. Common inhabitant of coral reefs, typically resting at the bases of coral heads.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 31569). Spawning ascents into the water column occurred over a distance of 0.2 to 0.6 m (Ref. 54536).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhitichthys falco

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTNGTATTTGGTGCTTGAGCTGGAATAGTCGGCACAGCCCTCAGCCTACTCATTCGAGCGGAACTTAGCCAACCCGGCGCTCTTCTAGGGGATGACCAGATTTATAACGTAATCGTTACAGCCCACGCCTTTGTAATGATTTTCTTTATGGTTATACCAATCATGATTGGTGGCTTTGGTAACTGACTGATTCCTCTAATGATTGGGGCCCCCGACATGGCGTTCCCCCGAATGAACAACATAAGCTTCTGACTTCTTCCCCCCTCATTCCTATTACTTCTAGCCTCCTCTGGGGTTGAAGCAGGGGCAGGAACAGGATGAACGGTATATCCCCCACTGGCAGGCAACCTCGCCCATGCGGGAGCATCGGTAGACCTAACTATTTTCTCTCTCCACCTTGCTGGGATTTCTTCAATTCTAGGGGCCATCAATTTTATTACGACCATCATTAACATGAAACCCCCCTCTATTTCTCAGTACCAAACCCCCCTATTTGTATGAGCTGTCCTTATTACAGCCGTTCTCCTTCTCCTCTCTCTTCCAGTTCTTGCAGCTGGCATTACAATGCTGCTAACAGACCGGAATCTAAACACAACCTTCTTTGACCCGGCAGGAGGGGGAGACCCAATTCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhitichthys falco

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dwarf hawkfish

The dwarf hawkfish, Cirrhitichthys falco, is a small species of hawkfish found on tropical reefs in the Indo-Pacific region from the Maldives to the Caroline Islands and Samoa. It can sometimes be found in the aquarium trade.[1]

Description[edit]

The dwarf hawkfish can reach 7 cm (2.8 in) in total length. The dorsal fin has ten spines with numerous tassels on the tips of the spines. The anal fin has three spines and six soft rays. The pectoral fins are thick and elongated and spread out when the fish is resting on the substrate. This fish is pinkish-red and white in color with vertical banding or mottling.[1]

Distribution and habitat[edit]

The dwarf hawkfish is native to the tropical Indo-Pacific. Its range extends from the eastern coast of Africa and the Maldives to Samoa, the Ryukyu Islands, northern Australia, the Great Barrier Reef and New Caledonia. It is a common member of the reef community on outer reef slopes and flats and is found at depths down to about 45 m (148 ft).[1]

Behavior[edit]

The dwarf hawkfish typically rests at the bottom of massive corals. It usually occurs singly but may be in pairs and feeds on fish larvae, small crustaceans and other invertebrates on the seabed.[1]

Like many fish, this species can change sex. A dominant male keeps a harem of several females. If a harem becomes too large, one of the females may become a male and take on part of the harem as a dominant male. What makes this species unusual is that the new male may revert to the female sex if challenged by a more powerful male. A male can become a female and successfully breed, laying fertile eggs.[2]

References[edit]

  1. ^ a b c d "Cirrhitichthys falco Randall, 1963: Dwarf halkfish". FishBase. Retrieved 2013-12-26. 
  2. ^ Whyte, C. Transgender fish perform reverse sex flip. New Scientist January 6, 2012.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!