Overview

Comprehensive Description

Biology

Commonly found in lakes and rivers (Ref. 9258). Inhabits stony rivers (Ref. 9072). Migrates to the sea to breed. Oviparous (Ref. 205). Marketed fresh, smoked and frozen; eaten fried and broiled (Ref. 9988). Reports of reaching up to 2 meters and 50 kilograms are rare and more common historically; in recent times, only a few exceed 120 cm TL (Ref. 82796).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southwest Pacific: endemic to New Zealand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

185 cm TL (male/unsexed; (Ref. 44724)); 156 cm TL (female); max. published weight: 25.0 kg (Ref. 11115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Anguilla dieffenbachii (Anguila diffenbachii) preys on:
detritus
Ameletopsis perscitus
Aoteapsyche raruraru
Coloburiscus humeralis
Deleatidium
Hydrobiosis parumbripennis
Terrestial invertebrates
Amelotopsis perscitus
Aoteapsyche
Larsia II
Helicopsyche albescens
Olinga feredayi
Potamopyrgus antipodarum
Pycnocentrodes
Zephlebia spectabilis
Austrosimulium australense
Cricotopus II
Eukiefferiella
Pirara
Ephydrella
Hydora nitida
Olinga feredayii
Oxyethira albiceps
Psilachorema bidens

Based on studies in:
New Zealand: Otago, Akatore, Akatore catchment (River)
New Zealand: Otago, Dempster's Stream, Taieri River, 3 O'Clock catchment (River)
New Zealand: Otago, Little Kye, Kye Burn catchment (River)

This list may not be complete but is based on published studies.
  • Thompson, RM and Townsend CR. 2005. Energy availability, spatial heterogeneity and ecosystem size predict food-web structure in streams. OIKOS 108: 137-148.
  • Townsend, CR, Thompson, RM, McIntosh, AR, Kilroy, C, Edwards, ED, Scarsbrook, MR. 1998. Disturbance, resource supply and food-web architecture in streams. Ecology Letters 1:200-209.
  • Thompson, RM and Townsend, CR. 1999. The effect of seasonal variation on the community structure and food-web attributes of two streams: implications for food-web science. Oikos 87: 75-88.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 60 years (wild) Observations: In the wild, these animals have been reported to live up to 60 years (Das 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla dieffenbachii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGCACCGCACTAAGCCTTCTAATCCGTGCCGAATTAAGTCAACCTGGCGCCCTTCTTGGAGATGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTTATGATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGGTTTGGCAACTGACTCGTACCATTAATGATCGGCGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGTTTCTGACTTTTACCCCCATCATTTCTTCTACTACTAGCCTCCTCGGGAGTAGAGGCTGGGGCTGGAACAGGATGAACCGTATATCCACCTCTAGCTGGAAACTTAGCCCACGCCGGAGCATCTGTTGACCTGACAATTTTCTCACTTCACCTTGCAGGTATCTCATCAATTCTAGGGGCCATTAATTTTATCACTACAATTATTAACATGAAACCACCTGCCATCACACAATATCAAACCCCTCTGTTTGTATGAGCTGTATTAGTAACCGCTGTTCTGCTACTCCTATCCCTGCCAGTCCTAGCCGCAGGTATTACGATACTTCTAACTGACCGAAATCTAAATACAACCTTCTTTGACCCTGCAGGAGGTGGAGACCCAATCCTCTACCAACACCTATTCTGATTTTTCGGCCACCCAGAAGTATACATTTTAATCTTACCAGGATTTGGAATAATCTCACACATTGTTGCTTATTATTCAGGTAAGAAAGAACCTTTTGGGTATATAGGAATGGTCTGAGCAATGATAGCTATCGGACTACTAGGGTTCATTGTGTGAGCACACCATATGTTTACAGTAGGAATAGACGTAGACACCCGGGCTTACTTCACTTCCGCCACAATAATCATCGCAATTCCAACCGGAGTAAAAGTATTCAGCTGACTAGCCACATTACACGGAGGGGTCATCAAATGAGAAACCCCACTTCTTTGAGCTTTAGGCTTTATTTTCCTATTCACAGTTGGGGGCCTAACAGGTATCGTACTAGCAAACTCATCAATCGATATTGTATTACATGACACATACTATGTAGTAGCCCATTTCCATTATGTTCTGTCTATAGGAGCAGTATTTGCTATTATAGGAGGCTTCGTACACTGATTCCCACTATTTTCGGGCTATACACTACATAACACATGAACCAAAGTACACTTTGGAATTATGTTCGTAGGAGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGCTTAGCAGGAATACCACGGCGTTACTCAGACTACCCAGATGCCTATACCCTATGAAATACAATCTCCTCTATTGGATCCCTAATTTCTCTCACAGCCGTAGTTCTGTTCCTATTTATCCTCTGAGAAGCATTTACTGCCAAACGAGAGGTAAAATGAGTAGAACTTACAGAAACAAATGTTGAATGACTACACGGGTGTCCTCCACCATATCACACATTCGAAGAACCAGCGTACGTCCGAGTCCAACCGCCCTCAGATGATCAAAAATCAGAAGCCAAAACCCATATTCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla dieffenbachii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: experimental
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

New Zealand longfin eel

The New Zealand Longfin eel (Anguilla dieffenbachii) is New Zealand's only endemic freshwater eel.[1][2] The other species of eel found in New Zealand are the native Shortfin eel (Anguilla australis) which is also found in Australia, and the sporadically naturally introduced Australian Longfin eel (Anguilla reinhardtii).[1][2][3][4]

The easiest method for identification of the New Zealand Longfin eel is by the length of its fins: the dorsal (top) fin extends further forward towards the head than the anal (bottom) fin. In the Shortfin Eel the fins are of similar lengths.[5]

The New Zealand Longfin eel is classified as a threatened species in gradual decline by the Department of Conservation.[6]

New Zealand Longfin eels also have gained some notoriety, particularly after being featured in the 16th episode of River Monsters, in which they were shown to have attacked and even killed humans.

General biology[edit]

Like other members of the Anguillidae family Longfin Eels have a rather unusual migration system where they grow and mature into fertile adults in freshwater water systems then migrate to the sea to breed; a catadromous breeding system.[7]
This breeding system also ensures that their mating system is randomised (panmictic population).[5][8]

The New Zealand Longfin eel is a very long lived fish with records of females reaching 106 years old and weighing up to 24 kg.[9][10] Longfin Eels have the slowest growth rate of any eel species studied, growing between 1 - 2 centimetres a year.[11][12]

Male and female Longfin Eels differ in length and in the age at which they migrate with males averaging 666 mm but reaching up to 735 mm in length with an average age of 23 years (12 – 35 years).[5][9] Female Longfin Eels are considerably larger with an average length of 1156 mm, but can range from 737 to 1560 mm. These females range in age from 20 to 60 years before migrating.[9] The average age of migration varies between the North and South Islands of New Zealand with the North Island eels having younger migration ages and thus faster generation times.[3]

Life stages[edit]

Longfin eel seen in a river at night in the Tararua Ranges

Longfin eels life cycle like other species of Angullidae eels is rather complex consisting of four distinct life stages which remained a mystery for many decades and still is not fully understood.[5][9][13][14]

New Zealand longfins breed only once at the end of their lifecycle,[11] making a journey of thousands of kilometres from New Zealand. They migrate to their spawning grounds in Tonga.[13][15] their eggs (of which each female eel produces between 1 and 20 million[5][16]) are fertilized in an unknown manner but is thought to occur in deep tropical water.[5] The mature eels then subsequently die, with their eggs floating to the surface hatching into very flat leaf-like larvae (leptocephalus larvae) that then drift along large oceanic currents back to New Zealand.[5][13][17] This drifting is thought to take up to 15 months.[5] There have been no recorded captures of either the eggs or larvae of Longfin eels.[13] Upon arrival back in New Zealand the larvae undergo a transformation (metamorphosis) into glass eels, which resemble small adult eels but are transparent.[5] These glass eels occupy estuaries during which time they develop colouration[5] and become elvers, resembling small adult Longfin eels.[5][14] The elvers (young eel) migrate upstream where they develop into adults.[5][14][18][19]

Recruitment[edit]

The recruitment of glass eels into the freshwater river networks in New Zealand is a very variable process which is thought to be affected by the El Niño and La Niña Southern Oscillations.[15] This is a major reason for the failure of Longfin eels aquaculture farms in the 1970s.[2][5]

Sex determination[edit]

The determination of the sex of Longfin eels is a difficult process as their sexual organs are not determined until they are over 450 mm in length.[8] The only method to determine Longfin eels sex is through internal examination and only becomes easy to distinguish when the eels mature and migrate.[5][8]

Diet[edit]

Longfin eels have an omnivorous diet and are opportunistic feeders.[20] Their diet as small eels largely consists of insect larvae.[5][20] When eels become larger, they also feed on small fish including galaxiids and trout.[5][20]

Habitat and distribution[edit]

External video
The Longfin Eel Migration –  River Monsters

The New Zealand Longfin eel is an endemic species to New Zealand with a very wide distribution through New Zealand's freshwater waterways including the Chatham Islands.[3][5][21]

Longfin eels are often found great distances inland (up to 361 km) along fresh waterways and in high country lakes which are connected to the sea.[3][5][10] Aiding in Longfin eels inland distribution is its climbing ability when it is in its elver (juvenile) life stage and is under 12 cm in length.[12][19] These migration events frequently coincide with increased temperate, water flow and low light conditions.[5][12][22] At this size the elvers (young eel) can migrate up to 130 km inland over a summer and has been observed climbing near vertical surfaces up to 43 m tall.[5] This feat is accomplished through a combination of surface tension (with the water) and friction.[19]

The in-stream distribution varies depending on the life stage of the Longfin eel. As elvers (juveniles) they prefer shallow water (under 0.5 m deep) with coarse substratum and faster than average stream flow (such as that found in stream riffle).[3][4] Adult Longfin eels tend to be found next to or under large pieces of debris and undercut river banks.[4][5]

Significance for Māori[edit]

The Longfin eel is an important resource for Māori because it provided an important food (protein) source.[12] Reflecting this significance for Māori they had extensive knowledge of Longfin eel's migratory routes.[5][12][16]

Longfin eel fishing[edit]

The commercial fishing of Longfin eels started to gain momentum in the 1960s and had a 2000 tonne yearly catch by the 1970s.[5][12] But the fishery went into decline in the early 1980s and in the 2000-2001 fishing season only 1079 tonnes were taken.[23] The commercial Longfin eel fishing was included into the Quota Management System (QMS) in 2000 for the South Island and the North Island in 2004. This set limits as to the minimum and maximum size (220 grams and 4 kg) and the Total Allowable Catch (TAC).[3][12] As of 2007 the TAC has not been reached in any fishing season since the implementation of the QMS.[3] In recognition of the significance of Longfin eels to Māori they have a 20 percent allocation of fishery stocks.[24] The capture and export of glass eels in New Zealand has been prohibited.[3]

Longfin eel aquaculture[edit]

There have been a number of attempts at growing Longfin eels in an aquaculture operation. The first were in the 1970s. These did not remain operational for long with the last farm closing in 1982.[2] The most common reasons for these failures were economic (the high cost of production vs low price for the eels), variable recruitment of glass eels and the high mortality (death) rates in the farms.[2] In the early 2000s there has been renewed interest in the aquaculture of Longfin eels due to the increasing knowledge of Longfins biology and the diminishing stocks of European eels (Anguilla anguilla) but no farms have been built.[2][7][8][12][16][25][26]

Conservation[edit]

Scientists and conservation groups have growing concern for the survival of the species as they can be legally fished, and have a slow reproduction rate, breeding only once at the end of their lifetime.[11][27] In 2003 a scientist predicted their numbers to drop by between 5 and 30% in the following decade.[11]

In June 2012 it was reported that some pet food companies use the nationally threatened eels in their products, sparking outrage by conservationists.[28]

Attacks on Humans and Livestock[edit]

New Zealand Longfin Eels have been reported to attack humans and livestock, something they are easily capable of doing thanks to their large size. It was only after the Animal Planet documentary series River Monsters aired that these attacks were made public knowledge and fact. Longfin Eels have been known to attack sheep, and the series host Jeremy Wade filmed the eels scavenging an elk carcass he used as bait en masse, in which they were shown to "death roll" like crocodiles to tear off chunks of meat. Humans have been killed by packs of long fin eels, but this is usually after the person has been incapacitated, such as crashing their car into a river or stream, and are unable to fight back. Bolder individual eels have been known to attack children, but this is extremely rare. [29]

References[edit]

  1. ^ a b "Eels". www.kcc.co.nz. Retrieved 27 June 2012. 
  2. ^ a b c d e f Watene, E. (2003). Potential for Commercial Eel Aquaculture in Northland. Auckland: National Institute of Water and Atmospheric Research.
  3. ^ a b c d e f g h Jellyman, D. J. (2007). Status of New Zealand fresh-water eel stocks and management initiatives. ICES J. Mar. Sci., fsm073. doi:10.1093/icesjms/fsm073
  4. ^ a b c Glova, G. J., Jellyman, D. J., & Bonnett, M. L. (1998). Factors associated with the distribution and habitat of eels (Anguilla spp.) in three New Zealand lowland streams. New Zealand Journal of Marine and Freshwater Research, 32(2), 255 - 269.
  5. ^ a b c d e f g h i j k l m n o p q r s t u v w McDowall, R. M. (1990). New Zealand freshwater fishes: a natural history and guide (Rev. ed.). Auckland: Heinemann-Reed.
  6. ^ "NZ Threat Classification System lists 2002 - Freshwater fish". Department of Conservation. Retrieved 27 June 2012. 
  7. ^ a b Doole, G. J. (2005). Optimal management of the New Zealand longfin eel (Anguilla dieffenbachii). Australian Journal of Agricultural and Resource Economics, 49(4), 395-411. doi:10.1111/j.1467-8489.2005.00310.x
  8. ^ a b c d Davey, A., & Jellyman, D. (2005). Sex Determination in Freshwater Eels and Management Options for Manipulation of Sex. Reviews in Fish Biology and Fisheries, 15(1), 37-52. doi:10.1007/s11160-005-7431-x
  9. ^ a b c d Todd, P. R. (1980). Size and age of migrating New Zealand freshwater eels (Anguilla spp.). New Zealand Journal of Marine and Freshwater Research, 14(3), 283 - 293.
  10. ^ a b Jellyman, D. J. (1995a). Longevity of longfinned eels Anguilla dieffenbachii in a New Zealand high country lake. Ecology of Freshwater Fish, 4(3), 106-112. doi:10.1111/j.1600-0633.1995.tb00123.x
  11. ^ a b c d "Native long-finned eels in great danger, says scientist". nzherald.co.nz. Retrieved 27 June 2012. 
  12. ^ a b c d e f g h Jellyman, D. J. (2009). Forty years on – the impact of commercial fishing on stocks of New Zealand freshwater eels (Anguilla spp.). Paper presented at the Eels at the edge: science, status, and conservation concerns. Proceedings of the 2003 International Eel symposium, Bethesda, Md.
  13. ^ a b c d Jellyman, D., & Tsukamoto, K. (2010). Vertical migrations may control maturation in migrating female Anguilla dieffenbachii. Marine Ecology Progress Series, 404, 241-247. doi:10.3354/meps08468
  14. ^ a b c Ryan, P. (2009). 'Eels - Life cycle and breeding grounds', Te Ara - the Encyclopedia of New Zealand Retrieved 29 August 2010, from http://www.TeAra.govt.nz/en/eels/3
  15. ^ a b Jellyman, D. (2006). Tagging along when longfins go spawning. Water & Atmosphere, 14(1), 24 - 25.
  16. ^ a b c Potangaroa, J. (2010). Tuna Kuwharuwhau - The Longfin Eel.
  17. ^ Chisnall, B. L., Jellyman, D. J., Bonnett, M. L., & Sykes, J. R. (2002). Spatial and temporal variability in length of glass eels (Anguilla spp.) in New Zealand. New Zealand Journal of Marine and Freshwater Research, 36(1), 89 - 104.
  18. ^ Boubée, J., Jellyman, D., & Sinclair, C. (2008). Eel protection measures within the Manapouri hydro-electric power scheme, South Island, New Zealand. Hydrobiologia, 609(1), 71-82. doi:10.1007/s10750-008-9400-6
  19. ^ a b c Jellyman, D. J. (1977). Summer upstream migration of juvenile freshwater eels in New Zealand. New Zealand Journal of Marine and Freshwater Research, 11(1), 61 - 71.
  20. ^ a b c Jellyman, D. J. (1995b). Diet of longfinned eels, Anguilla dieffenbachii, in Lake Rotoiti, Nelson Lakes, New Zealand. New Zealand Journal of Marine and Freshwater Research, 30(3), 365 - 369.
  21. ^ Jellyman, D. J., & Coates, G. D. (1976). The Farming of freshwater eels in New Zealand. Paper presented at the Indo-Pacific Fisheries Council 17th Session, Symposium on the Development and Utilisation of Inland Fishery Resources.
  22. ^ August, S., & Hicks, B. (2008). Water temperature and upstream migration of glass eels in New Zealand: implications of climate change. Environmental Biology of Fishes, 81(2), 195-205. doi:10.1007/s10641-007-9191-z
  23. ^ Beentjes, M. P., Boubée, J. A. T., Jellyman, D. J., & Graynoth, E. (2005). Non-fishing mortality of freshwater eels (Anguilla spp.). In M. o. Fisheries (Ed.), New Zealand Fisheries Assessment Report 2005/34 (pp. 38).
  24. ^ . Setting of Sustainability and Other Management Controls for Stocks to be Introduced into the QMS on 1 October 2004 - North Island Shortfin and Longfin Eels (SFS, LFE). (2004).
  25. ^ Rodríguez, A., Gisbert, E., Rodríguez, G., & Castelló-Orvay, F. (2005). Histopathological observations in European glass eels (Anguilla anguilla) reared under different diets and salinities. Aquaculture, 244(1-4), 203-214. doi:10.1016/j.aquaculture.2004.09.039
  26. ^ . Opportunities for Customary and Commercial Freshwater Aquaculture. (2009) (pp. 1 - 60): Te Wai Maori.
  27. ^ "'River monsters' fished out of West Coast lake". nzherald.co.nz. Retrieved 27 June 2012. 
  28. ^ "Threatened eels becoming pet food". 3 News. Retrieved 27 June 2012. 
  29. ^ River Monsters episode #16: Flesh Ripper
  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Anguilla dieffenbachii" in FishBase. February 2006 version.
  • Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8

Additional resources[edit]

Saving Tuna Documentary [1]

Long Finned Eel (Tuna)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!