Overview

Comprehensive Description

Biology

Adults inhabit coral and rocky reefs with some wave action (Ref. 9710) while juveniles are usually found in shallow water zones in lagoons and flat bottom areas. Feed on algae and sometimes on crustaceans and small invertebrates. Solitary or in loose aggregations (Ref. 9710). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: between Kenya and Natal, South Africa; also Aldabra, Madagascar, Réunion and Mauritius.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Kenya south to KwaZulu-Natal (South Africa), east to Aldabra, Madagascar and Mascarenes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 14; Analspines: 2; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 160 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

16.0 cm TL (male/unsexed; (Ref. 4391))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

With a prominent black blotch larger than eye on the middle of caudal peduncle.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Usually found in shallow water zones in lagoons and in flat bottom areas. Feeds on algae and sometimes on crustaceans and small invertebrates.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 6 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 1 - 100
  Temperature range (°C): 26.159 - 27.360
  Nitrate (umol/L): 0.048 - 0.337
  Salinity (PPS): 34.818 - 35.125
  Oxygen (ml/l): 4.660 - 4.700
  Phosphate (umol/l): 0.163 - 0.245
  Silicate (umol/l): 3.229 - 4.102

Graphical representation

Depth range (m): 1 - 100

Temperature range (°C): 26.159 - 27.360

Nitrate (umol/L): 0.048 - 0.337

Salinity (PPS): 34.818 - 35.125

Oxygen (ml/l): 4.660 - 4.700

Phosphate (umol/l): 0.163 - 0.245

Silicate (umol/l): 3.229 - 4.102
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 6m.
Recorded at 6 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adults inhabit coral and rocky reefs with some wave action (Ref. 9710) while juveniles are usually found in shallow water zones in lagoons and flat bottom areas. Feeds on algae and sometimes on crustaceans and small invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abudefduf sparoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCATGAGCTGGAATAGTAGGGACAGCCCTAAGCCTTCTTATCCGAGCAGAACTTAGCCAACCAGGTGCTCTCCTCGGGGATGACCAAATCTATAACGTAATTGTTACGGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCGATTATGATCGGAGGGTTTGGAAATTGACTAATCCCCCTAATGATTGGCGCCCCTGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTTCCTCCATCCTTCTTACTTCTTCTGGCCTCATCCGGAGTTGAAGCAGGTGCAGGAACAGGCTGAACTGTCTATCCACCACTATCGGGTAACCTAGCTCACGCAGGATCCTCTGTTGACCTAACTATTTTTTCCCTCCATCTAGCAGGTGTATCTTCAATCTTAGGAGCCATTAACTTTATTACTACAATTATTAATATAAAACCTCCCGCTATTTCTCAATATCAGACTCCCCTTTTCGTATGAGCCGTACTTATTACAGCCGTACTACTTCTTCTATCTCTCCCTGTTTTAGCCGCCGGAATTACAATACTTCTAACAGATCGAAACCTAAATACTACCTTTTTTGACCCAGCGGGGGGAGGAGATCCCATCCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Abudefduf sparoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!