Overview

Comprehensive Description

Biology

Occurs in lagoon and seaward reefs and is usually found on patch reefs or rocks (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the western Indian Ocean, and is found from Somalia (Sommer et al. 1992) to South Africa (Randall 1986) in the west, via the main Indian Ocean Islands, and eastwards to Madagascar and the Maldive Islands. It is also recorded in Sri Lanka (R. Myers pers. comm. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: south to Algoa Bay, South Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Western Indian Ocean: East Africa, Seychelles, Madagascar and western Mascarenes east to Maldives and Chagos Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 13; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 230 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

23.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is coral reef-associated (Masuda and Allen 1993), found on lagoon and seaward reefs to depths of 30 m. There appears to be no distinctive colour dimorphism in this species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 9710), usually 3 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 40 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 0.15 - 18.5
  Temperature range (°C): 27.134 - 28.339
  Nitrate (umol/L): 0.050 - 0.402
  Salinity (PPS): 34.563 - 35.125
  Oxygen (ml/l): 4.503 - 4.700
  Phosphate (umol/l): 0.163 - 0.239
  Silicate (umol/l): 2.864 - 4.752

Graphical representation

Depth range (m): 0.15 - 18.5

Temperature range (°C): 27.134 - 28.339

Nitrate (umol/L): 0.050 - 0.402

Salinity (PPS): 34.563 - 35.125

Oxygen (ml/l): 4.503 - 4.700

Phosphate (umol/l): 0.163 - 0.239

Silicate (umol/l): 2.864 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in lagoon and seaward reefs and is usually found on patch reefs or rocks (Ref. 9710). Also in coral reefs (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassoma hebraicum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Thalassoma hebraicum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTGTTCGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGAGCAGAGTTAAGCCAGCCCGGCGCCCTCCTTGGGGACGATCAGATTTACAACGTCATCGTTACAGCCCATGCATTCGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTCATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAACATAAGCTTTTGACTTCTCCCTCCCTCATTCCTGCTTCTTCTTGCCTCTTCTGGTGTCGAGGCGGGGGCCGGAACCGGGTGGACAGTTTACCCGCCCTTAGCAGGCAACCTTGCCCACGCTGGGGCGTCCGTTGACCTAACTATCTTCTCACTACATCTGGCAGGTATCTCATCAATCCTAGGTGCAATTAATTTCATCACAACCATTATTAATATGAAACCCCCAGCCATCTCTCAGTACCAAACGCCTCTTTTCGTATGAGCCGTTCTAATTACAGCAGTCCTTCTTCTCCTTTCCCTTCCAGTACTTGCTGCCGGTATTACAATGCTCCTCACGGATCGAAATCTGAACACTACCTTCTTTGACCCTGCCGGGGGAGGGGACCCAATTCTTTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pollard, D. & Cabanban, A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widepread in the Indian Ocean and is considered common throughout its range. There are no perceived major threats to this species, and it is present in several marine protected areas within its range. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is very common throughout its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is collected for the aquarium trade and is caught as food fish for subsistence fisheries. There is some destruction of its coral reef habitats in some parts of its range (Hodgson 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thalassoma hebraicum

The goldbar wrasse, Thalassoma hebraicum, is a species of wrasse native to the western Indian Ocean, where it inhabits reef environments at depths from 1 to 30 m (3.3 to 98 ft). This species can grow to 23 cm (9.1 in) in total length. It is a target of local traditional fisheries and can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Pollard, D. & Cabanban, A. 2010. Thalassoma hebraicum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma hebraicum" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!