Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits reef flats, clear shallow lagoons, and seaward reefs (Ref. 9710). Benthic (Ref. 58302). Feeds mainly on small crustaceans during both day and night (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 33390) to the Hawaiian, Marquesan, and Tuamoto islands, north to the Ryukyu Islands, south to the Great Barrier Reef.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, KwaZulu-Natal (South Africa), Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands and Marquesas Islands, north to Ryukyu Islands and Minami Tori Shima, south to Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0; Vertebrae: 132 - 137
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

72.3 cm TL (male/unsexed; (Ref. 90102))
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits primarily reef flats, clear shallow lagoons, and seaward reefs. Feeds mainly on small crustaceans during both day and night (Ref. 9710).
  • Froese, R. & D. Pauly (Editors). (2014). FishBase. World Wide Web electronic publication.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body grey with fine pale barring (Ref. 48635). Young with 25-30 dark brown bars separated by white narrow interspaces; bars become obscure with age where in large adults, the pattern becomes mottled brown; corner of mouth dark brown. Head usually lighter, yellowish with variable dark blotching (Ref. 48635). Description: Characterized by origin of dorsal fin anterior to gill opening; anus near middle of body; without canine teeth; conical to rounded molariform jaw teeth; broad plate vomer of molariform teeth (up to over 50 in large individuals) (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Poecilophis pikei Bliss
Catalog Number: USNM 153564
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): N. Pike
Year Collected: 1871
Locality: Mauritius, Mascarene Islands, Indian
  • Syntype: Bliss, R. 1883. Transactions of the Royal Society of Arts and Sciences of Mauritius. 13: 61.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Echidna leihala Jenkins
Catalog Number: USNM 50844
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): O. Jenkins
Year Collected: 1889
Locality: Reef In Front of Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Type: Jenkins, O. P. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 428, fig. 9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 20 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 52 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 0.08 - 104
  Temperature range (°C): 22.018 - 29.336
  Nitrate (umol/L): 0.016 - 5.453
  Salinity (PPS): 34.109 - 37.646
  Oxygen (ml/l): 4.016 - 4.802
  Phosphate (umol/l): 0.083 - 0.708
  Silicate (umol/l): 0.910 - 6.667

Graphical representation

Depth range (m): 0.08 - 104

Temperature range (°C): 22.018 - 29.336

Nitrate (umol/L): 0.016 - 5.453

Salinity (PPS): 34.109 - 37.646

Oxygen (ml/l): 4.016 - 4.802

Phosphate (umol/l): 0.083 - 0.708

Silicate (umol/l): 0.910 - 6.667
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 10m.
From 1 to 10 meters.

Habitat: reef-associated. Ringed moray.  (Richardson, 1844)  Indo-Pacific 
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits reef flats, clear shallow lagoons, and seaward reefs (Ref. 9710). Benthic (Ref. 58302). Feeds mainly on small crustaceans during both day and night (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echidna polyzona

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCCTGTATTTAGTATTTGGGGCCTGAGCCGGAATGGTCGGCACCGCATTGAGCCTATTAATCCGAGCAGAACTAAGTCAGCCCGGGGCCCTACTAGGTGATGACCAAATTTATAATGTAATCGTAACAGCCCATGCTTTCGTAATGATTTTCTTTATAGTAATGCCAATTATAATTGGGGGTTTCGGAAATTGACTAATCCCTCTAATGATTGGTGCCCCAGACATAGCATTTCCTCGGATAAATAATATAAGCTTCTGACTTCTCCCTCCTTCATTTCTTCTACTTTTAGCTTCTTCTGGCGTCGAAGCAGGAGCTGGTACCGGATGAACTGTTTATCCCCCTCTTGCAGGAAATCTAGCCCACGCCGGAGCATCTGTTGATTTAACCATTTTTTCTCTTCATCTAGCAGGTGTCTCTTCAATTTTAGGAGCAATCAACTTTATTACAACCATTATTAACATAAAACCCCCTGCTATCACACAATACCAAACACCATTGTTTGTATGAGCAGTCTTAGTAACAGCAGTTCTTCTTCTACTCTCCCTTCCAGTTCTAGCTGCTGGTATTACAATGCTTTTAACAGATCGAAACCTAAATACAACCTTCTTTGATCCTGCAGGGGGTGGTGACCCAATTCTTTATCAACACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Echidna polyzona

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Barred moray

The Barred moray (Echidna polyzona, also known as the Dark-banded eel, the Girdled moray, the Girdled reef eel, the Many banded moray eel, the Ringed moray, the Ringed reef moray, the Striped moray, and the Zebra eel[2]) is a moray eel of the family Muraenidae.[3] It was described by John Richardson in 1845, originally under the genus Muraena. It is a marine, tropical eel which is known from the Indo-Pacific, including the Red Sea, East Africa, the Hawaiian Islands, the Marquesan Islands, the Tuamoto Islands, the Ryukyu Islands, and the Great Barrier Reef. It dwells at a depth range of 2 to 20 metres (6.6 to 65.6 ft), and leads a benthic lifestyle in reefs and shallow lagoons. Males can reach a maximum total length of 72.3 centimetres (28.5 in).[3]

The Barred moray's diet consists of shrimp such as Saron marmoratus, crabs, isopods, and polychaetes,[4][5] which it feeds on during both day and night. It is of commercial interest to both subsistence fisheries and the aquarium trade.[3]

A barred moray

References[edit]

  1. ^ Synonyms of Echidna polyzona st www.fishbase.org.
  2. ^ Common names of Echidna polyzona at www.fishbase.org.
  3. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2006). "Echidna polyzona" in FishBase. June 2006 version.
  4. ^ Food items reported for Echidna polyzona at www.fishbase.org.
  5. ^ 5389 Food and Feeding Habits Summary Echidna polyzona at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!