Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Common off sandy beaches and in shallow estuaries and lagoons; also found in sandy areas of coral reefs (Ref. 9710). Also offshore down to 50 m depth (Ref. 5578). May enter fresh water (Ref. 5578). Feeds on small fishes, bivalves, crabs, shrimps, worms (Ref. 3263) and jellyfishes (Ref. 37816). Ovoviviparous (Ref. 50449). Common catch of the demersal tangle net, bottom trawl, longline and beach seine fisheries (Ref.58048). Popular angling fish (Ref. 3263). Not esteemed as a food fish (Ref. 3263). Used in Chinese medicine (Ref. 12166). Tail is used as a decorative item (Ref. 27550). Utilized for its meat, skin (high value) and cartilage (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Wide-spread distribution in the Indian and western Pacific Oceans, from South Africa to northern Australia (White et al. 2006, Compagno 1998, W. White and B.M. Manjaji pers. obs. 2007).

Western Indian Ocean: South Africa to India, including the Red Sea and Gulf. Eastern Indian Ocean: India to Indonesia and northern Australia.

Northwest Pacific: Taiwan, Ryukyu Islands, southern Japan. Western Central Pacific: Australia, Papua New Guinea, Malaysia and Indonesia.

Mediterranean Sea: The species is thought to be a Lessepsian immigrant, having entered the Mediterranean Sea from the Red Sea through the Suez Canal (Serena 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific, including Red Sea; Mediterranean Sea immigrant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Red Sea (and eastern Mediterranean via Suez Canal) to southern Africa and French Polynesia, north to Taiwan, south to Australia. Also in the Arafura Sea (Ref. 9819). Collected from the estuary of the River Ganges (Ref. 33178). This name has been used for a number of similar spotted species (Ref. 6871). Probably a species complex (Ref. 35766). Its identity has been confused in many publications and Micronesian specimens should be re-examined (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2000 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

200 cm WD (male/unsexed; (Ref. 3263)); max. published weight: 120.0 kg (Ref. 3263)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Common off sandy beaches and in shallow estuaries and lagoons. Feeds on small fishes, bivalves, crabs, shrimps and worms (Ref. 3263). Ovoviviparous. Size at birth about 28 cm WD (Ref. 6871).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Huge stingray with conspicuous dark spots on a light brown disc; spots well-spaced in young but crowded to form reticulated pattern in adult; white ventrally; tail marked with bands of black and white; snout sharply pointed; disc with narrowly rounded outer corners, and tail long, slender and nearly three times body length when intact, with no caudal finfolds; disc without thorns but with band of flat denticles along midback (in adults); usually 1 medium-sized sting on tail (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Often found off sandy beaches and in shallow estuaries and lagoons and may enter freshwater; also found in sandy areas of coral reefs. Also occurs offshore to depths of at least 50 m (White et al. 2006).

Reproduction is viviparous, with histotrophy. Attains at least 148 cm disc width (DW) (White and Dhamadi 2007) (up to 450 cm total length in Compagno 1998). Males mature at 82?84 cm DW and size at birth is 21?28 cm DW (White et al. 2006, White and Dharmadi 2007, Manjaji 2004). Fecundity is probably low; one pregnant female observed possessed two embryos (B.M. Manjaji pers. obs.).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 20 - 50m.
From 20 to 50 meters.

Habitat: demersal. Honeycomb stingray.  (Forsskal, 1775)  Attains at least 6m (mostly tail) width 2m. Common off sandy beaches.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; amphidromous (Ref. 51243); brackish; marine; depth range 20 - 50 m (Ref. 28016)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 227 specimens in 1 taxon.
Water temperature and chemistry ranges based on 152 samples.

Environmental ranges
  Depth range (m): 15 - 155
  Temperature range (°C): 14.724 - 28.385
  Nitrate (umol/L): 0.164 - 10.770
  Salinity (PPS): 32.901 - 38.549
  Oxygen (ml/l): 2.079 - 5.557
  Phosphate (umol/l): 0.147 - 1.170
  Silicate (umol/l): 2.041 - 17.807

Graphical representation

Depth range (m): 15 - 155

Temperature range (°C): 14.724 - 28.385

Nitrate (umol/L): 0.164 - 10.770

Salinity (PPS): 32.901 - 38.549

Oxygen (ml/l): 2.079 - 5.557

Phosphate (umol/l): 0.147 - 1.170

Silicate (umol/l): 2.041 - 17.807
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common off sandy beaches and in shallow estuaries and lagoons; also found in sandy areas of coral reefs (Ref. 9710). Found on the continental shelf (Ref. 75154). Also offshore down to 50 m depth (Ref. 5578). May enter fresh water (Ref. 5578). Feeds on small fishes, bivalves, crabs, shrimps and worms.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205). Distinct pairing with embrace (Ref. 205). Bears 3 to 5 young in the summer (Ref. 5578). Size at birth about 21 (Ref.58048) - 28 cm WD (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Himantura uarnak i

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Himantura uarnak

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTTAGTCTGCTCATTCGAACAGAGCTAAGCCAACCAGGTGCACTACTAGGTGAT---GATCAGATCTATAACGTGATTGTTACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATTGGAGGCTTTGGTAACTGGCTCGTTCCCCTAATA---ATCGGTGCCCCAGACATAGCCTTTCCCCGAATAAATAACATAAGTTTCTGACTTCTACCCCCATCCTTTCTCCTACTTTTGGCCTCTGCTGGAGTTGAGGCAGGAGCTGGAACAGGTTGAACTGTCTACCCCCCACTAGCTGGTAACCTAGCACATGCCGGAGCTTCAGTAGACCTG---GCAATCTTCTCACTACACCTAGCCGGTGTCTCTTCTATCCTAGCCTCCATTAATTTTATCACCACAATTATCAACATAAAACCACCAGCAATCTCACAATATCAAACACCTCTCTTTGTCTGATCAATCCTCATTACAGCTGTACTTCTCTTACTATCCCTCCCTGTCTTAGCAGCA---GGCATTACAATACTTCTCACAGACCGTAACCTCAACACAACCTTCTTTGACCCTGCAGGAGGAGGTGACCCCATTCTTTACCAACACCTCTTCTGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura uarnak

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+3bd+4bd

Version
3.1

Year Assessed
2009

Assessor/s
Manjaji, B.M. & White, W.T.

Reviewer/s
Valenti, S.V. & Pollard, D. (Shark Red List Authority)

Contributor/s

Justification
The Reticulate Whipray (Himantura uarnak) is a large stingray with a wide distribution in the Indian and Western Pacific Oceans. It is taken as a utilised bycatch of tangle/gillnet, trawlnet, and dropline fisheries throughout southeast Asia and parts of the Indian Ocean. This species is an anti-Lessepsian migrant, having entered the Mediterranean Sea from the Red Sea through the Suez Canal. Reticulate Whipray faces many of the same threats as other Himantura species within its range, however, its large size at maturity and maximum size, low fecundity and preference for shallow waters (which are being heavily utilised and degraded in many parts of its range), suggest that it may be more vulnerable than some of its congeners. Inshore fishing pressure is intense throughout this species? range in southeast Asia and in parts of the Indian Ocean. It is caught in particularly high numbers in the target fishery for rhynchobatids operating in the Arafura Sea. Although no species-specific data are available, overall catches of stingrays are reported to be declining, with fishermen having to travel further and further to sustain catch levels. Aggregated time series data for rays also shows a steady decline from 1973?1994 in the Gulf of Thailand. Although species-specific data are not available, given the species? suspected vulnerability, significant declines significant declines are suspected to have occurred as a result of high levels of exploitation across large areas of its range. Conversely, this species has refuge from fishing pressure in areas such as northern Australia, where fishing pressure is light and bycatch mitigation measures are in place. The species is assessed as Least Concern, regionally, in Australia. Globally, it is assessed as Vulnerable on the basis of overall suspected declines as a result of high levels of exploitation in large areas of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Uncommon throughout much of its range (B.M. Manjaji pers. obs. 2007), but appears to be common in parts of northern Australia (W. White. pers. obs. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Himantura uarnak faces many of the same threats as other Himantura species within its range, however, its large size at maturity and maximum size and preference for shallow waters (which are being heavily utilised and degraded in many parts of its range), suggest that it may be more vulnerable than its congeners (B.M. Manjaji, Fahmi, W. White, pers. Obs. 2007).

This species is captured by demersal tangle net, bottom trawl and, to a lesser extent, longline fisheries in Indonesia (White et al. 2006) and across large parts of its range. Its inshore distribution overlaps with coastal artisanal and commercial fisheries throughout large areas of the Indian and western Pacific oceans.

It is taken in commercial gillnet fisheries off Indonesia, particularly in the fishery that targets rhynchobatid rays in the Arafura Sea, and retained (Last and Compagno 1999, W. White pers. obs. 2007). It is thought to be heavily impacted in this area, where more than 600 trawl vessels operate (W. White pers. obs. 2007). The Rhynchobatus species gillnet fishery catches large numbers of stingrays and Himantura uarnak is important in this fishery. Catches in inshore waters have declined and these vessels are having to travel longer and longer distances to sustain catches. The rhynchobatid fisheries are very intensive in this region, thus the level of exploitation is extremely high. There is also evidence that fisherman in these regions increasingly illegally fish in Australian waters (Chen 1996, W. White, unpubl. data).

In Sabah (Malaysia) and Indonesia, Himantura species are often caught and landed in the inshore fisheries (trawls and longlines) and are also taken by Danish seine fishing gear (M. Manjaji and Fahmi pers. obs. 2007). In Southeast Asia, most specimens caught as bycatch by commercial fisheries (especially trawlers) are landed and sold as food fish.

Demersal fishing pressure has increased in both effort and capacity in many areas of this species? inshore range during recent decades. For example, demersal resources in the Gulf of Thailand went from being lightly exploited to severely over-exploited between 1973 and 1994 (Pauly et al. 2005). Available time series data for grouped biomass of ?rays? for this area and period applied to an ecostystem model for the area, suggested that this group was one of the most severely impacted by the initial increase in fishing pressure, showing a steady declining trend (Pauly et al. 2005). Species-specific catch data are not collected, but aggregated landings data for ?Rays, stingrays, mantas, nei? are reported to FAO by some countries. Indonesian landings increased from ~10,000 t in 1975 to almost 60,000 t in 2003. Data are not available for India, but data for Pakistan show that landings increased to a peak of 53,000 t as early as 1982, after which landings dropped to ~10,000 t in 1983 and have not risen above 21,000 t since (FAO 2008).

This species? preference for inshore waters, shallow estuaries and lagoons means it is also threatened by extensive habitat degradation and loss of mangrove forest. It may also be affected by destructive fishing practices and pollution. Extensive areas of mangrove forest have been lost in Indonesia and Malaysia through conversion of land for shrimp farms, excessive logging, urban development and, to a lesser extent, conversion of land to agriculture or salt pans (FAO 2007). Between 1980 and 2005 combined overall mangrove area in Indonesia and Malaysia was reduced by >30% (FAO 2007).

Although species-specific data are not available, given that this is a large species with low fecundity and a preference for shallow waters (where threats from coastal fisheries and habitat degradation are greatest), significant declines are suspected to have occurred as a result of over-exploitation in fisheries in Southeast Asia, the northern Indian Ocean, and elsewhere in areas of high exploitation.

Conversely, this species has refuge from fishing pressure in areas such as northern Australia, where fishing pressure is light and bycatch mitigation measures are in place. Large specimens are caught as bycatch in the Australian Northern Prawn Trawl Fishery, but the introduction of Turtle Exclusion Devices (TEDs) and other exclusion devices is thought to have greatly reduced bycatch of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bd+3bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Further research is required on taxonomy, as is assessment of catches throughout its range.

In Malaysia, the Shark Specialist Group together with various government departments in Sabah and Sarawak States have initiated elasmobranch biodiversity studies since 1996 (Fowler et al. 2002). While the monitoring surveys should continue to ascertain the status and possible threats to this species here, as well as in other portions of its range (New Guinea and Indonesia), efforts in further research should be directed to also obtain the population, habitat and ecology and life history parameters. The fishery is largely unregulated (licenses being issued, but catches/ landings are not properly monitored), and presently there is no specific conservation actions in place to help address this problem.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Reticulate whipray

The reticulate whipray or honeycomb stingray (Himantura uarnak) is a species of stingray in the family Dasyatidae. It inhabits coastal and brackish waters across the Indo-Pacific region from South Africa to Taiwan to Australia, favoring sandy habitats. A large species reaching 2 m (6.6 ft) in width, the reticulate whipray has a diamond-shaped pectoral fin disc and an extremely long tail without fin folds. Both its common and scientific names refer to its ornate dorsal color pattern of many small, close-set dark spots or reticulations on a lighter background. However, the reticulate whipray is only one of several large spotted stingrays in the Indo-Pacific which, coupled with the variability of its coloration with age and locality, has resulted in a great deal of taxonomic confusion.

Often encountered resting on the bottom during daytime, the reticulate whipray is a predator of bottom-dwelling invertebrates and bony fishes. Like other stingrays, it is aplacental viviparous, with the developing embryos nourished at first by yolk and later by histotroph ("uterine milk"). Females bear litters of up to five pups in summer, following a gestation period of a year. The reticulate whipray is fished in Southeast Asia and parts of the Indian Ocean for meat, skin, cartilage, and other purposes. It is highly susceptible to population depletion because of its large size, inshore habits, and low reproductive rate, and is additionally threatened by extensive habitat degradation. Consequently, the International Union for Conservation of Nature (IUCN) has assessed this species as Vulnerable.

Taxonomy and phylogeny[edit]

In 1775, Carsten Niebuhr published Descriptiones animalium – avium, amphibiorum, piscium, insectorum, vermium: quæ in itinere orientali observavit, the work of his late friend, the Swedish naturalist Peter Forsskål. Within Forsskål had described Raja sephen, now commonly known as the cowtail stingray, with a spotted variant he called uarnak, derived from an Arabic word that describes the color pattern. No type specimen was designated.[2] Forsskål's account formed the basis for two subsequent writings that named the spotted ray as a distinct species: Pierre Joseph Bonnaterre's Raia scherit in 1788, and Johann Friedrich Gmelin's Raja uarnak in 1789. Although Bonnaterre's name was published first and thus would have had precedence, later authorities have regarded Forsskål's uarnak as the earliest available name even though it was not initially part of a binomial. Consequently, modern sources give uarnak as the valid specific epithet and either Gmelin or Forsskål as the species authority.[3][4] In 1837, Johannes Peter Müller and Friedrich Gustav Jakob Henle included the reticulate whipray in the newly created genus Himantura; David Starr Jordan and Barton Warren Evermann made it the type species in 1896.[5]

The reticulate whipray is closely related to H. undulata and H. leoparda, which share much of its range. All three species are very similar in size, shape, and color pattern, resulting in a long history of taxonomic confusion that only recently is starting to be untangled. In 2004, Mabel Manjaji described the 'uarnak' species complex, containing H. fai, H. gerrardi, H. jenkinsii, H. leoparda, H. toshi, H. uarnak, and H. undulata, plus three more undescribed species.[6] The reticulate whipray itself varies in appearance throughout its range, and further taxonomic comparisons are required to determine whether its spotted and reticulated color morphs in fact represent different species.[1] Alternate common names for this ray include coachwhip ray, leopard stingray, longtail stingray, and marbled stingray; some of these names are shared by other, similar species.[7]

Description[edit]

A stingray with many small dark spots and a thin black tail
The reticulate whipray has a dorsal color pattern of many small dark spots.

The pectoral fin disc of the reticulate whipray is diamond-shaped and wider than long, with the leading margins almost straight and the snout and outer corners angular. In juveniles, the disc is about as wide as long, with a more obtuse snout and rounded corners. The eyes are small and immediately followed by the spiracles (paired respiratory openings). A short and wide curtain of skin with a minutely fringed rear margin is present between the long, thin nostrils. The mouth is relatively small, with a deep concavity at the center of the lower jaw and shallow furrows at the corners extending onto the lower jaw.[8] A row of 4–5 papillae (nipple-like structures) is found across the floor of the mouth. There are 26–40 upper tooth rows and 27–44 lower tooth rows.[9] The pelvic fins are small and triangular. The tail is whip-like and extremely thin, measuring 3–3.5 times as long as the disc when intact, and lacks fin folds. Usually one serrated stinging spine is located on the upper surface on the tail, some distance from the base.[8]

Adult rays have a wide band of flattened, heart-shaped dermal denticles that extend from between the eyes to the tail spine, increasing in density with age, along with two large pearl thorns at the center of the back. The tail behind the spine is covered by small thorns. The dorsal band of denticles is largely developed by the time the juveniles are 50 cm (20 in) across. The coloration of the reticulate whipray varies substantially with age and locality. Adults generally have a dorsal pattern of numerous closely spaced dark brown spots or reticulations on a beige to yellow-brown background, which becomes blackish past the spine with lighter bands on the sides. The underside is pale, without markings. Juveniles are yellowish above with tiny, densely packed dark spots, around seven spots in a line between the spiracles, and three rows of spots in front of the sting.[8] This large species has been reported to reach a disc width of 2 m (6.6 ft), a total length of 6 m (20 ft), and a weight of 120 kg (260 lb).[7][9]

Distribution and habitat[edit]

A dark-spotted stingray in an aquarium with a sandy bottom and a rocky far wall
The reticulate whipray frequents areas with fine sediment.

The reticulate whipray occurs widely in the Indo-Pacific, with a range extending from off eastern South Africa to the Arabian Peninsula, westward along the coast of the Indian subcontinent to Southeast Asia, and reaching as far as Taiwan and the Ryukyu Islands to the north, and New Guinea and northern Australia to the southeast. It has also colonized the eastern Mediterranean Sea through the Suez Canal. This species seems to be common only in Australian waters, where it occurs from Shark Bay to Brisbane.[1][8]

Bottom-dwelling in nature, the reticulate whipray is generally encountered over sandy flats near beaches, in lagoons, and around coral reefs, from the intertidal zone to offshore waters 50 m (160 ft) deep or more.[1] In Shark Bay, it frequents intertidal sand flats during the warm season, and shifts to slightly deeper seagrass patches in the cold season.[10] This species is tolerant of low salinities and has been known to enter estuaries and mangrove swamps,[11] though records from fresh water in Southeast Asia are unverified and may represent misidentifications.[12] Its preferred water temperatures are 23–26 °C (73–79 °F).[13]

Biology and ecology[edit]

Two spotted stingrays with many other fish splashing in the surf
Two reticulate whiprays and other fish being fed on a beach near Darwin, Australia.

During the day, the reticulate whipray is generally inactive and spends much time resting motionless on the sea floor, sometimes buried in sand.[11] In Shark Bay, Western Australia, this ray can be found resting singly or in small groups in very shallow water during high tide. Its lateral line extends to the tip of its extremely long tail, giving it advance warning of approaching predators such as bottlenose dolphins (Tursiops aduncus) and hammerhead sharks (Sphyrna). The cowtail stingray (Pastinachus sephen) prefers to rest with the reticulate whipray over others of its own species, because the whiprays' longer tails grant them superior predator detection. These mixed-species groups often settle into a "rosette" with their tails pointing radially outward for maximum predator awareness.[14]

The reticulate whipray preys on a variety of benthic and neritic organisms, including crabs, shrimps, mantis shrimps, bivalves, gastropods, worms, jellyfish, and bony fishes.[7][15] In the western Indian Ocean, about two-thirds of its diet consists of fishes, in particular ponyfish and anchovies, with shrimps and other crustaceans making up most of the remainder.[16] By contrast, rays in Australian waters are apparently not piscivorous, and are known to consume penaeid prawns.[17] Known parasites of this species include Anthrobothrium loculatum,[18] Dendromonocotyle colorni,[19] Halysiorhynchus macrocephalus,[20] Monocotyle helicophallus, M. multiparous, and M. spiremae,[21] Thaumatocotyle australensis,[22] and Tylocephalum chiralensis.[23]

Like other stingrays, the reticulate whipray is aplacental viviparous: the developing embryos are initially sustained by yolk, which is later supplanted by histotroph ("uterine milk", enriched with proteins and lipids) produced by the mother.[1] Females give birth to up to five pups in the summer, after a year-long gestation period.[15] Off South Africa, the newborns measure 28–30 cm (11–12 in) across and sexual maturation is attained at a disc width of approximately 1 m (3.3 ft), which corresponds to an age of 4-5.[24] Off Australia, the newborns measure 21–28 cm (8.3–11 in) across, with males reported to mature at 82–84 cm (32–33 in) across.[8] The juveniles of this species, H. leoparda, and H. undulata differ in birth size, disc shape, denticle development, and amount of spotting, and are in fact more distinct from each other than are adults of the three species.[6] Shark Bay may serve as a nursery area for young rays.[10]

Human interactions[edit]

A spotted stingray with a long tail, lying on sand with a nurse shark in an aquarium
A reticulate whipray at the Palais de la Porte Dorée Tropical Aquarium in Paris.

The reticulate whipray fights strongly on hook-and-line and is thus popular with recreational anglers, who usually release it alive.[24] This species is caught by intensive artisanal and commercial fisheries operating in Southeast Asia and parts of the Indian Ocean, using bottom trawls, gillnets and tangle nets, beach seines, and longlines. In particular, it is caught in substantial numbers by an Indonesian trawl fishery targeting wedgefishes in the Arafura Sea.[1] The meat, skin, and cartilage are utilized, though this species is not a highly valued food fish. It also has applications in Chinese medicine, and its tail may be sold as a curio.[7]

The International Union for Conservation of Nature (IUCN) has listed the reticulate whipray as Vulnerable. Its large size, inshore habitat preferences, and slow reproductive rate render it susceptible to overfishing. Although specific data is lacking, significant declines in overall ray catches have been documented within its range, including in the Gulf of Thailand, the Arafura Sea, and off Pakistan. Habitat degradation also threatens this species: over 30% of the mangroves in Indonesia and Malaysia have been cleared since 1980, while pollution and destructive fishing practices may have also taken their toll. Australian waters offer the reticulate whipray a refuge from fishing pressure, as there it is not targeted commercially and the installation of Turtle Exclusion Devices (TEDs) have reduced bycatch mortality. However, there are indications of increasing illegal fishing in Australian territory by Indonesian vessels.[1]

References[edit]

  1. ^ a b c d e f g Manjaji, B.M. and W.T. White (2004). Himantura uarnak. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved April 8, 2010.
  2. ^ Forsskål, P.S. (1775). Niebuhr, C, ed. Descriptiones animalium – avium, amphibiorum, piscium, insectorum, vermium: quæ in itinere orientali observavit. ex officina Mölleri. pp. 17–18. 
  3. ^ Eschmeyer, W.N. ed. uarnak, Raja. Catalog of Fishes electronic version (February 19, 2010). Retrieved on April 8, 2010.
  4. ^ Fricke, R. (2008). "Authorship, availability and validity of fish names described by Peter (Pehr) Simon Forsskål and Johann Christian Fabricius in the 'Descriptiones animalium' by Carsten Niebuhr in 1775 (Pisces)". Stuttgarter Beiträge zur Naturkunde A, Neue Serie 1: 1–76. 
  5. ^ Jordan, D.S. and B.W. Evermann (October 3, 1896). "The fishes of North and Middle America: a descriptive catalogue of the species of fish-like vertebrates found in the waters of North America, north of the Isthmus of Panama (Part I)". Bulletin of the United States National Museum 47: 1–1240. 
  6. ^ a b Last, P.R. and Manjaji-Matsumoto, B.M. (2008). "Himantura leoparda sp. nov., a new whipray (Myliobatoidei: Dasyatidae) from the Indo–Pacific". In Last, P.R., W.T. White and J.J. Pogonoski. Descriptions of New Australian Chondrichthyans. CSIRO Marine and Atmospheric Research. pp. 292–302. ISBN 0-1921424-1-0 (corrected) ISBN 1-921424-18-2 (invalid, listed in publication). 
  7. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2009). "Himantura uarnak" in FishBase. March 2009 version.
  8. ^ a b c d e Last, P.R. and J.D. Stevens (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. pp. 449–440. ISBN 0-674-03411-2. 
  9. ^ a b Smith, J.L.B., Smith, M.M. and Heemstra, P. (2003). Smiths' Sea Fishes. Struik. pp. 139–140. ISBN 1-86872-890-0. 
  10. ^ a b Vaudo, J.J. and M.R. Heithaus (2009). "Spatiotemporal variability in a sandflat elasmobranch fauna in Shark Bay, Australia". Marine Biology 156: 2579–2590. doi:10.1007/s00227-009-1282-2. 
  11. ^ a b Ferrari, A. and A. Ferrari (2002). Sharks. Firefly Books. p. 220. ISBN 1-55209-629-7. 
  12. ^ Compagno, L.J.V. and T.R. Roberts (1982). "Freshwater stingrays (Dasyatidae) of Southeast Asia and New Guinea, with description of a new species of Himantura and reports of unidentified species". Environmental Biology of Fishes 7 (4): 321–339. doi:10.1007/BF00005567. 
  13. ^ Last, P.R. and Compagno, L.J.V. (1999). "Myliobatiformes: Dasyatidae". In Carpenter, K.E. and Niem, V.H. FAO identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Rome: Food and Agricultural Organization of the United Nations. pp. 1479–1505. ISBN 92-5-104302-7. 
  14. ^ Semeniuk, C.A.D. and L.M. Dill (2006). "Anti-Predator Benefits of Mixed-Species Groups of Cowtail Stingrays (Pastinachus sephen) and Whiprays (Himantura uarnak) at Rest". Ethology 112: 33–43. doi:10.1111/j.1439-0310.2006.01108.x. 
  15. ^ a b Michael, S.W. (1993). Reef Sharks & Rays of the World. Sea Challengers. p. 87. ISBN 0-930118-18-9. 
  16. ^ Randall, J.E. and J.P. Hoover (1995). Coastal fishes of Oman. University of Hawaii Press. p. 46. ISBN 0-8248-1808-3. 
  17. ^ Salini, J.P., S.J.M. Blaber and D.T. Brewer (Oct 1990). "Diets of piscivorous fishes in a tropical Australian estuary, with special reference to predation on penaeid prawns". Marine Biology 105 (3): 363–374. doi:10.1007/BF01316307. 
  18. ^ Vijayalakshmi, C. and S. Sarada (June 1993). "Studies on the new species Anthrobothrium loculatum parasite from Dasyatis (Himantura) uarnak (Forskal)". Boletín Chileno de Parasitología 48 (1-2): 12–16. 
  19. ^ Chisholm, L.A., I.D. Whittington and G.C. Kearn (2001). "Dendromonocotyle colorni sp. n. (Monogenea: Monocotylidae) from the skin of Himantura uarnak (Dasyatididae) from Israel and a new host record for D. octodiscus from the Bahamas". Folia Parasitologica 48 (1): 15–20. PMID 11266131. 
  20. ^ Beveridge, I. and R.A. Campbell (June 1992). "Redescription of Halysiorhynchus macrocephalus (Cestoda: Trypanorhyncha), a genus newly recorded from the Australasian region". Systematic Parasitology 22 (2): 151–157. doi:10.1007/BF00009607. 
  21. ^ Measures, L.N., M. Beverley-Burton and A. Williams (October 1990). "Three new species of Monocotyle (Monogenea: Monocotylidae) from the stingray, Himantura uarnak (Rajiformes: Dasyatidae) from the Great Barrier Reef: phylogenetic reconstruction, systematics and emended diagnoses". International Journal for Parasitology 20 (6): 755–767. doi:10.1016/0020-7519(90)90009-C. PMID 2242960. 
  22. ^ Beverley-Burton, M. and A. Williams (1989). "Merizocotyle icopae, Sp-Nov, and Thaumatocotyle australensis, Sp-Nov, (Monogenea, Monocotylidae) From the Nasal Cavities of Rajiform Elasmobranchs of the Great-Barrier-Reef". Australian Journal of Zoology 37 (1): 25–35. doi:10.1071/ZO9890025. 
  23. ^ Vijayalakshmi, C. and S. Sarada (July–December 1995). "Studies on the new species Tylocephalum chiralensis, parasite from Dasyatis (Himantura) uarnak (Förskal) from Chirala coast, Andhra Pradesh, India". Boletín Chileno de Parasitología 50 (3-4): 73–75. 
  24. ^ a b Heemstra, E. (2004). Coastal fishes of Southern Africa. NISC and SAIAB. p. 83. ISBN 1-920033-01-7. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!