Overview

Comprehensive Description

Biology

Occur often far up rivers, but also in estuaries and in Lakes Alexandrina and Albert near mouth of a river (Ref. 188). Most commonly inhabit streams coursing through relatively dry eucalyptus-scrub or desert areas, preferring sluggish or quiet waters (Ref. 5259, 44894). Also found in saline lakes (slightly less salty than sea water). Tolerant of water temperatures between 9° and 38°C and pH 4.8-8.6. Although these fish have a wide tolerance of temperature and pH, they are susceptible to oxygen depletion and are usually the first to perish when ephemeral habitats begin to dry up. Common length is 15-20 cm (Ref. 44894). Frequently noted in large shoals that feed on benthic algae; also feed on insects and small crustaceans. Spawning may occur repeatedly in the north with a peak during the wet season; probably annual in the south (Ref. 5259, 44894).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Oceania and Asia: Rivers of Australia and southwestern Papua New Guinea (from Fortescue River near Dampier Archipelago in Western Australia, eastward in rivers through the Northern Territory and Queensland south to the Murray-Darling system; also the Finke River, affluent to Lake Eyre; Bensbach River (Ref. 6993) and Digoel River in New Guinea.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia and Papua New Guinea; Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0; Analsoft rays: 17 - 26
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 480 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

48.0 cm SL (male/unsexed; (Ref. 6390))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Belly with 14 to 18 (usually 16 to 17) - 11 to 14 (usually 12 or 13), total 25 to 31 (usually 20 to 30) scutes. Anterior arm of pre-operculum with fleshy triangular area above, not covered by third infra-orbital bone (see N. come). Edge of lower jaw strongly flared outward. Pectoral axillary scale rudimentary or absent. Hind edge of scales not toothed. A dark spot behind gill opening.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic; potamodromous (Ref. 51243); freshwater; brackish; depth range 0 - 3 m (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.5 - 1

Graphical representation

Depth range (m): 0.5 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 3m.
Recorded at 3 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Both larval and juvenile bony bream are pelagic (Ref. 26397). Juveniles feed on zooplankton initially then at 5-6 cm length, they switch to a diet of detritus and algae (Ref. 26401). The young are often found near macrophytes and other submerged terrestial vegetation. During the day, they are found in groups in shallow backwaters or bays (Ref. 26399).Adults in general, live in a variety of habitats including shallow backwaters and artesian bones, over mud, clay, and sand. Also floodplain, lagoons, main river channels, and sandy lowland creeks in still or flowing water or clear to very turbid waters. Adults prefer open water (Ref. 6390).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

In more northerly part of its range, spawning may take place several times over the year but is probably annual in southern localities.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nematalosa erebi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTTGGTGCCTGAGCGGGGATAGTAGGGACTGCCCTAAGCCTTCTTATCCGAGCGGAGCTCAGCCAACCGGGTGCGCTCCTAGGGGATGATCAAATTTATAATGTTATCGTTACGGCGCATGCCTTCGTAATGATTTTCTTCATAGTAATGCCAATCATGATCGGAGGCTTTGGTAACTGGTTAGTACCCCTAATGATCGGAGCACCCGACATAGCATTCCCGCGAATAAATAATATGAGCTTCTGACTTCTTCCACCCTCCTTCCTTCTTCTCCTCGCTTCTTCAGGAGTAGAAGCCGGGGCAGGGACAGGGTGAACGGTTTATCCACCTCTGTCAGGCAATCTAGCTCACGCAGGAGCATCAGTTGATTTGACCATTTTTTCCCTTCATCTTGCAGGTATTTCGTCAATCCTTGGAGCAATTAATTTTATTACTACAATTATTAACATAAAACCCCCTGCAATTTCACAATACCAAACACCCCTGTTTGTATGGGCAGTTCTTGTCACTGCCGTGCTGCTGCTTCTATCCCTCCCAGTCCTAGCTGCCGGTATCACCATGCTTCTTACCGACCGAAATCTAAATACGACGTTCTTCGACCCCGCGGGGGGAGGAGACCCAATTCTTTATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nematalosa erebi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bony bream

Bony bream Nematalosa erebi are a widespread and common, small to medium sized Australian freshwater fish often found in large shoals throughout much of northern and central Australia, and the Murray-Darling basin.

Description[edit]

A deep bodied, laterally compressed fish with a blunt snout.[1][2] Spineless dorsal fin with the posterior ray developedinto a long filament.[1] Usually silver overall, sometimes grey to greenish dorsally.[1] In Victoria it has been reported to develop a rusty red tinge especially around the mouth[2] which is thought to be related to breeding.[1] Some populations develop a dark blotch on the shoulder.[1]

Distribution[edit]

Common and widespread throughout its range, found in the Pilbara, Timor Sea, Gulf of Carpentaria, Northeast Coast, Murray-Darling (at elevations below 200 metres, 650 ft) Are present in Tinaroo Dam, elevation 660m, often referred to as "Barra lollies" because of a tendency for impoundment barramundi to round them up[2] and Lake Eyre Australian drainage divisions. Tends to forms large shoals near the bottom.[1]

Habitat[edit]

Variable, but mostly in shallow areas of slow flowing or still rivers and streams, especially in turbid conditions; desert bores; and, fresh or saline lakes (up to almost sea water salinity). Can tolerate water temperatures between 9° and 38°C and a pH between 4.8 and 8.6. Despite these wide tolerances, bony bream are susceptible to low oxygen levels and are often the first species to succumb when ephemeral habitats begin to dry up.[1]

Diet[edit]

Primarily feeds on benthic algae but also consumes detritus and small invertebrates.[1]

References[edit]

  1. ^ a b c d e f g h Allen, G.R.; Midgley, S.H.; Allen, M (2002). Freshwater Fishes of Australia. Western Australian Museum. pp. 64–65. ISBN 0-7307-5486-3. 
  2. ^ a b c McDowall, R.M. (1992). Freshwater Fishes of South Eastern Australia (Rev. ed.). Reed. pp. 44–46. ISBN 0-7301-0462-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!