Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Whiting is a predator fish. It has long pointed teeth for devouring other fish. Its favorite food is eel-pout, sprat, lesser sandeel, herring, cod, haddock and ... other whiting. Young whiting don't eat fish but squid, crustaceans and worms. Whiting larvae often hide between the tentacles of jellyfish, where they are protected from their enemies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The fish matures at between three and four years of age, and spawning takes place at a depth of 20 to150m. The time of the spawning varies from location to location: from January to spring in the Mediterranean; from January to September in the area between the British Isles and the Bay of Biscay; and throughout the year in the Black Sea. A large female can produce up to one million eggs. The eggs float in the open ocean and the larval whiting swim with other sea plankton until they have attained a length of around 10 cm. The fish grow quickly, with females growing faster than males, and can live to about ten years of age. The diet of the whiting consists of bottom-living organisms, such as crabs, shrimps, small fish, molluscs, worms, squid and cuttlefish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The whiting is similar in appearance to its larger relatives the cod, the haddock, the coley and the pollack. It has three dorsal fins separated by small gaps, the third fin extending almost to the tail fin. The tail is not forked, having almost a square end. The two anal fins are very close together, nearly touching one another and, together with the anterior fin, are elongated. The pectoral fin is also long and projects beyond the base of the anal fin. The whiting's upper jaw projects slightly beyond the lower, and the lateral line is continuous along the length of the body. In colour, individual fish vary quite a lot, and there is often a small dark blotch at upper base of the pectoral fin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

More commonly found from 30 to 100 m, mainly on mud and gravel bottoms, but also on sand and rock. Feed on shrimps, crabs, mollusks, small fish, polychaetes and cephalopods. Migrate to the open sea only after the first year of life. Eggs are pelagic. Larvae and juveniles are associated with jellyfish. Upon maturity, small chin barbel characteristic of juveniles disappear (Ref. 53061). Spawn in batches (Ref. 51846). Utilized fresh, dried or salted, smoked and frozen; eaten steamed, broiled and baked (Ref. 9988).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The whiting Merlangius merlangus is a cod-like fish. It has an elongated body with a small head and a pointed snout. It can grow up to 70 cm in length. It has a blue-green upper colouring and is silvery-white underneath. It has three dorsal fins and two anal fins. The pectoral fins are on the side and the pelvic fins are near the gills. The tail is truncate. Its upper jaw projects above the lower jaw. A small dark spot is found at the base of the pectoral fins and the lateral line is brown in colour.It can be differentiated from similar species such as the haddock, Melanogrammus aeglefinus, by a small dark spot which is found at the base of the pectoral fins and by the lateral line being brown and not black. It is very similar to the blue whiting, Micromesistius poutassou, but can be distinguished by the dorsal fins being close together.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Black Sea and Sea of Azov, Sea of Marmara, Mediterranean Sea: Aegean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belgian Exclusive Economic Zone, Bray-Dunes, Bredene, British Isles, De Haan, European waters (ERMS scope), Greek Exclusive Economic Zone, Grevelingen, Irish Exclusive economic Zone, Mariakerke, Middelkerke, Oostduinkerke, Oosterschelde, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Voordelta, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Atlantic: southeastern Barents Sea and Iceland to Portugal, also in the Black Sea, Aegean Sea, Adriatic Sea and adjacent areas. Rare in the northwestern Mediterranean.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Baltic Sea, North Sea, Mediterranean Sea, Black Sea, eastern Atlantic: Barents Sea and Iceland to Portugal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The whiting ranges from the eastern North Atlantic to the south eastern Barents Sea, and from Iceland to Portugal. It is also found in the Black Sea, Aegean Sea, and Adriatic Sea, but is uncommon in the northwestern Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 30 - 40; Analsoft rays: 30 - 35
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 1371)); max. published weight: 3,110 g (Ref. 40637); max. reported age: 20 years (Ref. 35388)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body elongate; head small. Chin barbel small or absent. Lateral-line canals on head with pores. Color is variable; yellowish-brown, dark blue or green, sides yellowish grey, white and silvery on belly; often with a small dark blotch at the upper base of the pectoral fin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 51243); marine; depth range 10 - 200 m (Ref. 1371), usually 30 - 100 m (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 490182 specimens in 1 taxon.
Water temperature and chemistry ranges based on 316098 samples.

Environmental ranges
  Depth range (m): -9 - 300
  Temperature range (°C): 3.624 - 12.243
  Nitrate (umol/L): 1.402 - 16.868
  Salinity (PPS): 8.255 - 35.584
  Oxygen (ml/l): 2.113 - 7.708
  Phosphate (umol/l): 0.247 - 1.790
  Silicate (umol/l): 0.987 - 50.947

Graphical representation

Depth range (m): -9 - 300

Temperature range (°C): 3.624 - 12.243

Nitrate (umol/L): 1.402 - 16.868

Salinity (PPS): 8.255 - 35.584

Oxygen (ml/l): 2.113 - 7.708

Phosphate (umol/l): 0.247 - 1.790

Silicate (umol/l): 0.987 - 50.947
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The whiting is a benthopelagic species usually found as depths of 30-100 m. It can be found near mud and gravel bottoms, but also above sand and rock.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 200m.
From 10 to 200 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This fish is a bottom-dweller in water no deeper than 200 metres. It prefers mud and gravel beds but is also recorded on rocky bottoms. The young fry spend about a year in much shallower waters of no more than 30m depth, before migrating to the adult feeding grounds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Lives above the bottom and often near the surface. Young live closer to the shore. Proportion of fish in the diet increases with age (Ref. 3663).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Merlangius merlangus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATTCGAGCAGAGCTAAGTCAACCTGGTGCACTCCTTGGTGAT---GATCAAATTTATAATGTAATCGTTACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTCGGCAACTGACTAATTCCCCTAATGATCGGTGCTCCAGATATAGCTTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTTCCCCCATCTTTCCTACTCCTTTTAGCATCATCTGGTGTAGAAGCCGGAGCCGGGACAGGTTGAACTGTCTATCCCCCTTTAGCTGGAAACCTCGCTCATGCTGGGGCATCTGTTGACCTCACTATTTTTTCCCTTCATCTGGCAGGAATTTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAACATAAAACCTCCAGCAATCTCACAATATCAAACTCCCCTCTTTGTTTGAGCAGTCCTAATTACAGCTGTGCTTCTATTATTATCTCTTCCAGTCTTAGCAGCCGGTATCACAATACTTTTAACTGATCGTAATCTTAATACTTCTTTCTTTGATCCTGCTGGAGGAGGTGACCCCATTTTATATCAGCATCTATTCTGATTCTTCGGCCACCCCGAAGTATACATTCTTATTTTACCTGGATTCGGAATAATTTCCCATATCGTAGCATACTATTCAGGTAAAAAAGAACCCTTTGGATATATAGGAATAGTTTGAGCTATGATGGCCATTGGCCTTCTTGGCTTTATTGTATGAGCCCATCATATGTTTACAGTCGGAATGGACGTAGATACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Merlangius merlangus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Not subject to specific protection, but listed by the International Council for the Exploration of the Seas (ICES) as below Safe Biological Limits (SBL).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The biggest threat to this species is over-harvesting by the fishing fleets of many nations. Although the whiting is still a fairly numerous species, in common with a number of other commercially important fish it is now feared that there are more being caught by trawlers than reproduce annually. Domestic pressure on governments to support their fishing industries has led to the situation where overfishing takes place, and agreed quotas are exceeded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The whiting is listed in the UK Biodiversity Grouped Action Plan for commercial marine fish. Being a species that is found in international waters, it has proved very difficult to impose restrictions on the number of fish that can be harvested from the sea without reducing fish stocks below the important Safe Biological Limits (SBL) figure. The whiting is listed in the part of the UK Grouped Action Plan dealing with fish stocks in the Celtic Sea, and the total allowable catch (TAC) figure for this region was cut to 35% in 2001. At the moment, it appears that elsewhere the whiting's populations have not dropped below the SBF. It remains to be seen whether implementation of the rules and recommendations in the current Common Fisheries Policy (CFP) will allow population levels to stabilise and recover. One side effect of the original CFP has been to remove inefficient fishing boats from the fleets, allowing heavy overfishing by the 'factory' trawlers. This, coupled with the pressure on individual governments to support their country's own fishing fleets, has led to the harvesting of 'black fish', catches above and beyond a country's legal quota.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; aquarium: public aquariums; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Merlangius merlangus

Merlangius merlangus, commonly known as whiting is an important food fish in the eastern North Atlantic Ocean and the northern Mediterranean, western Baltic, and Black Seas. In English-speaking countries outside the whiting's natural range, the name has been applied to various other species of fish.

Until the late 20th century, whiting was a cheap fish, regarded as food for the poor or for pets, but the general decline in fish stocks means it is now more highly valued. The other fish that have been given the name whiting are mostly also food fish.

Parasites

Whiting and related cod species are plagued by parasites. These include the cod worm, Lernaeocera branchialis, a copepod crustacean that clings to the gills or the fish and metamorphoses into a plump, sinusoidal, wormlike body, with a coiled mass of egg strings at the rear.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!