Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occur in clear lagoon and sheltered seaward reefs (Ref. 9710). Adults usually along deep drop-offs (Ref. 48637). Usually close to shelter. Occur singly (Ref. 9710). Feed on algae, sponges, and benthic invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa south to Natal, South Africa (Ref. 4919) and east to Samoa, northward to the Ryukyus and western sea of Japan, southward to New Caledonia and Queensland, Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa and western Mascarenes east to Samoa, north to Ryukyu Islands, south to southern Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 12; Analspines: 0; Analsoft rays: 10 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 650 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

65.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in clear lagoon and sheltered seaward reefs. Feeds on algae, sponges, and benthic invertebrates. Usually close to shelter. Generally uncommon and solitary (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body covered with prickles (Ref. 559). Body beautifully colored; black area around anus, black reticulations below pectoral fins (Ref. 4919).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 4 - 30 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 0.61 - 8.5
  Temperature range (°C): 27.236 - 28.954
  Nitrate (umol/L): 0.057 - 0.622
  Salinity (PPS): 33.507 - 35.002
  Oxygen (ml/l): 4.522 - 4.676
  Phosphate (umol/l): 0.055 - 0.247
  Silicate (umol/l): 0.888 - 3.155

Graphical representation

Depth range (m): 0.61 - 8.5

Temperature range (°C): 27.236 - 28.954

Nitrate (umol/L): 0.057 - 0.622

Salinity (PPS): 33.507 - 35.002

Oxygen (ml/l): 4.522 - 4.676

Phosphate (umol/l): 0.055 - 0.247

Silicate (umol/l): 0.888 - 3.155
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Mapp puffer.  (Lesson, 1827)  
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on plants and benthic invertebrates (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Philometra Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arothron mappa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACGGCCCTTAGCCTCCTTATTCGGGCTGAACTCAGCCAACCAGGCGCACTCCTGGGCGATGACCAGATTTATAATGTAATCGTCACAGCCCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGTGGCTTCGGGAACTGACTAGTGCCACTTATGATCGGAGCCCCTGACATGGCGTTCCCTCGAATGAACAACATAAGCTTTTGACTGCTTCCCCCTTCCTTCCTCCTTCTCCTAGCATCCTCTGGTGTAGAAGAGGGAGCTGGTACGGGCTGAACCGTCTATCCACCACTAGCGGGCAATTTGGCCCACGCAGGAGCATCCGTCGACCTTACCATCTTCTCCCTCCACCTAGCAGGTGTCTCGTCAATCCTTGGCGCCATTAACTTCATCACCACAATCATTAACATAAAACCCCCGGCCATCTCTCAGTACCAAACACCCCTGTTCGTATGGGCCGTTATAATCACTGCCGTCCTCCTCTTGTTATCCCTGCCAGTCCTCGCGGCAGGAATCACGATGCTCCTCACAGACCGGAACCTAAACACCACCTTCTTCGACCCCGCAGGCGGAGGAGACCCAATCCTCTATCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arothron mappa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Map puffer

Arothron mappa, also known as the Map pufferfish , is a demersal Marine fish belonging to the family Tetraodontidae.

Contents

Description[edit]

Arothron mappa is a medium sized fish which grows up to 65 cm length.[1] Its body is oval shape, spherical et relatively elongated. The skin is not covered with scales. The fish has no pelvic fin and no lateral line.The dorsal fin and the anal fin are small, symmetric and located at the end of the body. Its snout is short with two pairs of nostrils and its mouth is terminal with four strong teeth.[2]

The background coloration is whitish with dense network of black, brown or geenish broken lines,with an irradiant line departure from the eye. Depending on specimen, some dark or yellowish blotches can occur around the mouth, the anus, on the fins or anywhere on the body.

Distribution & habitat[edit]

This species is found in tropical and subtropical waters from the Indian Ocean to the western Pacific Ocean.[3] It lives close to reef drop-off and sheltered lagoons from the surface to 30 m depth.[4]

Feeding[edit]

Arothron mappa feeds on benthic invertebrates, sponges and algaes.[5]

Behaviour[edit]

This pufferfish has a diurn activity, it's solitary.[6]

Potential Danger[edit]

Arothron mappa secretes a violent poison, the tetrodotoxin, which protect it from voracious predators.

References[edit]

  1. ^ http://www.fishbase.org/summary/Arothron-mappa.html
  2. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
  3. ^ http://eol.org/pages/216802/details#distribution
  4. ^ http://www.fishbase.org/summary/Arothron-mappa.html
  5. ^ http://eol.org/pages/216802/details#trophic_strategy
  6. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!