Overview

Comprehensive Description

Biology

Territorial, inhabit shallow lagoon and subtidal reef flats. Form large aggregations above staghorn Acropora thickets or in smaller groups above isolated coral heads. Feed on zooplankton, benthic invertebrates, and algae. Males invite females to spawn in their nests; protecting the eggs until they hatch and becoming very aggressive against other fish. Eggs hatch after 3-5 days; pelagic larvae feed on plankton (Ref. 5503). Oviparous, distinct pairing during breeding (Ref. 205). Used in behavioral study. Have been reared in captivity (Ref. 35412).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to the Line, Marquesan and Tuamoto islands, north to southern Japan, south to Sydney, Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Djibouti, East Africa, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll, Marquesas Islands and Gambier Islands, north to Ryukyu Islands, south to Western Australia, Lord Howe Island, New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 11 - 13; Analspines: 2; Analsoft rays: 11 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 4391)); max. reported age: 6 years (Ref. 72479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Color in life white with 3 black bars; a large brown spot on dorsal part of snout and interorbital; lips dusky or white; caudal fin pale; pelvic fins black; pectorals transparent. Margins of preorbital, suborbital, and preoperculum finely serrated.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Territorial, inhabits shallow lagoon and subtidal reef flats. Forms large aggregations above staghorn @Acropora@ thickets or in smaller groups above isolated coral heads. Feeds on zooplankton, benthic invertebrates, and algae. Males invite females to spawn in their nests; protecting the eggs until they hatch and becoming very aggressive against other fish. Eggs hatch after 3-5 days; pelagic larvae feeds on plankton (Ref. 5503).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 190 specimens in 1 taxon.
Water temperature and chemistry ranges based on 152 samples.

Environmental ranges
  Depth range (m): 0.15 - 28
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.043 - 2.517
  Salinity (PPS): 32.019 - 36.148
  Oxygen (ml/l): 4.271 - 5.079
  Phosphate (umol/l): 0.079 - 0.495
  Silicate (umol/l): 0.721 - 5.501

Graphical representation

Depth range (m): 0.15 - 28

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.043 - 2.517

Salinity (PPS): 32.019 - 36.148

Oxygen (ml/l): 4.271 - 5.079

Phosphate (umol/l): 0.079 - 0.495

Silicate (umol/l): 0.721 - 5.501
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated. Zebra humbug.  (Linnaeus, 1758) Attains 10 cm. A distinctive species with a white body and three black bars. The front bar follows the shape of the head and the middle bar is angled backwards. Commonly forms aggregations of 30 or more fish which shelter among branched madreporian corals on sheltered reefs in 1 - 20 metres. When they feel threatened the dart in unison for shelter among the coral branches. Feeds mainly on attached algae, fish eggs and various benthic animals. Nests at the base of coral. Southeastern Polynesia and Line Islands to Red Sea down to East Africa south to Northern Natal. Although it has been recorded down to Durban, it is rare south of Inhaca Island in Mozambique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Territorial, inhabits shallow lagoon and subtidal reef flats. Forms large aggregations above staghorn Acropora thickets or in smaller groups above isolated coral heads. Feeds on plants and invertebrates (Ref. 6110). Harem-type social structure observed with 1 male & several females with linear size dependent rank order; male spawned with the females in order of rank & may attempt to male with females from nearby territories. Male & largest female protect the home territory. It is associated with coral heads (usually Acropora or Pocillopora) that have a tree-like form, allowing the fish to retreat deep within the branches. Humbug lives only where the coral heads are interspersed with sandy patches, usually in protected lagoons or sheltered bays, only occasionally on outer slopes (Ref. 54301).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male selects and protects the nest; does the courtship `dance' about 1 m above the nest and escorts the attracted female to the nest site where spawning ensues (Ref. 33146). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dascyllus aruanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCCTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTACTTATTCGAGCAGAACTAAGCCAACCAGGCGCTCTCCTAGGGGACGACCAAATTTATAATGTCATCGTCACAGCGCATGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGAAACTGACTGATTCCCCTTATAATCGGAGCTCCTGATATAGCATTCCCTCGGATAAACAACATAAGCTTCTGACTTTTACCCCCCTCATTCCTTCTTTTACTGGCCTCTTCTGGTGTTGAAGCAGGTGCAGGCACAGGTTGAACTGTATATCCTCCTCTATCAGGGAACTTAGCCCATGCAGGAGCCTCTGTAGACCTAACCATTTTCTCACTTCACCTAGCAGGGATTTCTTCAATCCTGGGAGCAATCAACTTTATCACAACCATCATTAACATGAAGCCTCCTGCCATCACCCAATACCAAACCCCTCTCTTCGTATGAGCCGTCCTCATCACCGCTGTTCTTCTCCTTCTATCCCTTCCGGTCTTGGCCGCTGGAATTACCATGCTCTTAACCGATCGCAACTTAAATACTACCTTTTTCGACCCTGCGGGAGGGGGAGATCCAATCCTCTATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dascyllus aruanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Whitetail dascyllus

Also known as the three-stripe damsel, humbug dascyllus, banded dascyllus or white-tailed damselfish.

Contents

Description

Length up to 10 cm, they are white with three black vertical bars.

Habitat

Associated with coral reefs, most usually in groups above Acropora coral heads. Males may be aggressive against other fish while they tend eggs.

Distribution

Western Pacific Ocean including Red Sea, and Indian Ocean

Aquarium

They are called aquarium 'Starter fish' as they are quite tolerant of variable conditions and aid in conditioning the tank environment for less hardy fish. These fish have been reared in captivity. They can be territorial with other fish.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!