Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Territorial, inhabit shallow lagoon and subtidal reef flats. Form large aggregations above staghorn Acropora thickets or in smaller groups above isolated coral heads. Feed on zooplankton, benthic invertebrates, and algae. Males invite females to spawn in their nests; protecting the eggs until they hatch and becoming very aggressive against other fish. Eggs hatch after 3-5 days; pelagic larvae feed on plankton (Ref. 5503). Oviparous, distinct pairing during breeding (Ref. 205). Used in behavioral study. Have been reared in captivity (Ref. 35412).
  • Randall, H.A. and G.R. Allen 1977 A revision of the damselfish genus Dascyllus (Pomacentridae) with description of a new species. Rec. Aust. Mus. 31(9):349-385. (Ref. 2746)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to the Line, Marquesan and Tuamoto islands, north to southern Japan, south to Sydney, Australia.
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll, Marquesas Islands and Gambier Islands, north to Ryukyu Islands, south to Western Australia, Lord Howe Island, New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 11 - 13; Analspines: 2; Analsoft rays: 11 - 13
  • Randall, H.A. and G.R. Allen 1977 A revision of the damselfish genus Dascyllus (Pomacentridae) with description of a new species. Rec. Aust. Mus. 31(9):349-385. (Ref. 2746)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 4391)); max. reported age: 6 years (Ref. 72479)
  • Hinton 1962 Horned shark, gar, mormyriad, characin, carp, armored catfish, arowana, upside down catfish. Not given. (Ref. 72479)
  • Allen, G.R. 1986 Pomacentridae. p. 670-682. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4391)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Color in life white with 3 black bars; a large brown spot on dorsal part of snout and interorbital; lips dusky or white; caudal fin pale; pelvic fins black; pectorals transparent. Margins of preorbital, suborbital, and preoperculum finely serrated (Ref. 2746). Body depth 1.5-1.7 in SL (Ref. 90102).
  • Randall, H.A. and G.R. Allen 1977 A revision of the damselfish genus Dascyllus (Pomacentridae) with description of a new species. Rec. Aust. Mus. 31(9):349-385. (Ref. 2746)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Territorial, inhabits shallow lagoon and subtidal reef flats. Forms large aggregations above staghorn @Acropora@ thickets or in smaller groups above isolated coral heads. Feeds on zooplankton, benthic invertebrates, and algae. Males invite females to spawn in their nests; protecting the eggs until they hatch and becoming very aggressive against other fish. Eggs hatch after 3-5 days; pelagic larvae feeds on plankton (Ref. 5503).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 20 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 190 specimens in 1 taxon.
Water temperature and chemistry ranges based on 152 samples.

Environmental ranges
  Depth range (m): 0.15 - 28
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.043 - 2.517
  Salinity (PPS): 32.019 - 36.148
  Oxygen (ml/l): 4.271 - 5.079
  Phosphate (umol/l): 0.079 - 0.495
  Silicate (umol/l): 0.721 - 5.501

Graphical representation

Depth range (m): 0.15 - 28

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.043 - 2.517

Salinity (PPS): 32.019 - 36.148

Oxygen (ml/l): 4.271 - 5.079

Phosphate (umol/l): 0.079 - 0.495

Silicate (umol/l): 0.721 - 5.501
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated. Zebra humbug.  (Linnaeus, 1758) Attains 10 cm. A distinctive species with a white body and three black bars. The front bar follows the shape of the head and the middle bar is angled backwards. Commonly forms aggregations of 30 or more fish which shelter among branched madreporian corals on sheltered reefs in 1 - 20 metres. When they feel threatened the dart in unison for shelter among the coral branches. Feeds mainly on attached algae, fish eggs and various benthic animals. Nests at the base of coral. Southeastern Polynesia and Line Islands to Red Sea down to East Africa south to Northern Natal. Although it has been recorded down to Durban, it is rare south of Inhaca Island in Mozambique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Territorial, inhabits shallow lagoon and subtidal reef flats. Forms large aggregations above staghorn Acropora thickets or in smaller groups above isolated coral heads. Feeds on plants and invertebrates (Ref. 6110). Harem-type social structure observed with 1 male & several females with linear size dependent rank order; male spawned with the females in order of rank & may attempt to male with females from nearby territories. Male & largest female protect the home territory. It is associated with coral heads (usually Acropora or Pocillopora) that have a tree-like form, allowing the fish to retreat deep within the branches. Humbug lives only where the coral heads are interspersed with sandy patches, usually in protected lagoons or sheltered bays, only occasionally on outer slopes (Ref. 54301).
  • Randall, H.A. and G.R. Allen 1977 A revision of the damselfish genus Dascyllus (Pomacentridae) with description of a new species. Rec. Aust. Mus. 31(9):349-385. (Ref. 2746)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male selects and protects the nest; does the courtship `dance' about 1 m above the nest and escorts the attracted female to the nest site where spawning ensues (Ref. 33146). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205).
  • Godwin, J. 1995 Phylogenetic and habitat influences on mating system structure in the humbug damselfishes (Dascyllus, Pomacentridae). Bull. Mar. Sci. 57(3):637-652. (Ref. 33146)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dascyllus aruanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCCTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTACTTATTCGAGCAGAACTAAGCCAACCAGGCGCTCTCCTAGGGGACGACCAAATTTATAATGTCATCGTCACAGCGCATGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGAAACTGACTGATTCCCCTTATAATCGGAGCTCCTGATATAGCATTCCCTCGGATAAACAACATAAGCTTCTGACTTTTACCCCCCTCATTCCTTCTTTTACTGGCCTCTTCTGGTGTTGAAGCAGGTGCAGGCACAGGTTGAACTGTATATCCTCCTCTATCAGGGAACTTAGCCCATGCAGGAGCCTCTGTAGACCTAACCATTTTCTCACTTCACCTAGCAGGGATTTCTTCAATCCTGGGAGCAATCAACTTTATCACAACCATCATTAACATGAAGCCTCCTGCCATCACCCAATACCAAACCCCTCTCTTCGTATGAGCCGTCCTCATCACCGCTGTTCTTCTCCTTCTATCCCTTCCGGTCTTGGCCGCTGGAATTACCATGCTCTTAACCGATCGCAACTTAAATACTACCTTTTTCGACCCTGCGGGAGGGGGAGATCCAATCCTCTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dascyllus aruanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Baensch, H.A. 1992 Neue Meerwasser-Praxis. Tetra Verlag, Melle, Germany. (Ref. 7309)
  • Allen, G.R. 1986 Pomacentridae. p. 670-682. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4391)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!