Overview

Comprehensive Description

Biology

Usually found immobile at the bottom camouflaged among rocks and coral. Hunts by ambushing prey (Ref. 5503). Unlike most scorpaenids, the sting from the dorsal spines of this species can be painful but does not pose any real danger to the victim (Ref. 5503). Sold fresh in small quantities in markets.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Indian Ocean: Kenya and Mozambique to islands in the western Indian Ocean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indian Ocean: East Africa to Madagascar, Comores, Réunion, Mauritius, Rodrigues (Mascarenes), Aldabra, Farquhar Islands, Seychelles and Chagos Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 5
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 210 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

21.0 cm SL (male/unsexed; (Ref. 3503))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A black spot nearly as large as eye on inner surface of pectoral fins near base of first 5 rays; no black mark inside mouth at front of upper jaw. Ascending process of premaxilla narrow, its maximum width 1.8-2.2 in orbit diameter; a series of papillae or nodules (sometimes on a low ridge) across interorbital space between supraocular spines; nasal spine single (Ref 42181).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Usually found immobile at the bottom camouflaged among rocks and coral. Hunts by ambushing prey (Ref. 5503). Unlike most scorpaenids, the sting from the dorsal spines of this species can be painful but does not pose any real danger to the victim (Ref. 5503). Sold fresh in small quantities in markets.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 23 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.15 - 150
  Temperature range (°C): 24.782 - 27.698
  Nitrate (umol/L): 0.050 - 0.279
  Salinity (PPS): 34.984 - 35.429
  Oxygen (ml/l): 4.660 - 4.806
  Phosphate (umol/l): 0.108 - 0.207
  Silicate (umol/l): 0.829 - 4.102

Graphical representation

Depth range (m): 0.15 - 150

Temperature range (°C): 24.782 - 27.698

Nitrate (umol/L): 0.050 - 0.279

Salinity (PPS): 34.984 - 35.429

Oxygen (ml/l): 4.660 - 4.806

Phosphate (umol/l): 0.108 - 0.207

Silicate (umol/l): 0.829 - 4.102
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Sluggish carnivore which lurks beneath coral heads and ledges on both interisland reef shallows and the seaward reef. It lies motionless while waiting for fish and invertebrates to venture close enough to capture (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scorpaenopsis gibbosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAGTATTTGGTGCCTGAGCTGGAATGGTTGGAACAGCCCTGAGCCTGCTCATTCGAGCAGAACTAAGCCAACCCGGAGCCTTACTAGGTGACGACCAGATCTACAATGTAATTGTTACGGCACATGCCTTTGTAATGATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGAAACTGACTAATTCCATTAATAATTGGAGCCCCAGATATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCACCTTCCTTCCTCCTCCTGCTGGCCTCCTCAGGTGTTGAAGCCGGTGCTGGAACTGGTTGAACAGTCTACCCACCCCTGGCTGGCAACCTAGCCCATGCGGGAGCCTCAGTAGACCTAACAATCTTTTCGCTCCATTTGGCGGGGATTTCCTCAATTCTTGGTGCAATTAATTTCATCACTACAATTATTAATATGAAGCCCCCAGCAATCTCTCAATATCAGACACCCCTGTTTGTATGAGCCGTTTTGATTACTGCTGTTCTCCTTCTTCTTTCCCTTCCTGTCCTTGCTGCTGGCATTACAATGCTTTTAACAGACCGTAATCTTAATACCACTTTCTTTGATCCCGCAGGAGGAGGAGATCCTATCCTTTATCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scorpaenopsis gibbosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!