Overview
Comprehensive Description
Biology
Usually found immobile at the bottom camouflaged among rocks and coral. Hunts by ambushing prey (Ref. 5503). Unlike most scorpaenids, the sting from the dorsal spines of this species can be painful but does not pose any real danger to the victim (Ref. 5503). Sold fresh in small quantities in markets.
-
Randall, J.E and W.N. Eschmeyer 2001 Revision of the Indo-Pacific scorpionfish genus Scopaenopsis, with descriptions of eight new species. Indo-Pac. Fish. (34):79 p. (Ref. 42181)
http://www.fishbase.org/references/FBRefSummary.php?id=42181&speccode=12080
Trusted
Distribution
Western Indian Ocean: Kenya and Mozambique to islands in the western Indian Ocean.
-
Randall, J.E and W.N. Eschmeyer 2001 Revision of the Indo-Pacific scorpionfish genus Scopaenopsis, with descriptions of eight new species. Indo-Pac. Fish. (34):79 p. (Ref. 42181)
http://www.fishbase.org/references/FBRefSummary.php?id=42181&speccode=12080
Trusted
Chagos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country)
-
MacNae, W. & M. Kalk (eds) (1958). A natural history of Inhaca Island, Mozambique. Witwatersrand Univ. Press, Johannesburg. I-iv, 163 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6266
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Smith, J.L.B. & M.M. Smith (1963). The fishes of Seychelles. Department of Ichthyology, Rhodes University. Grahamstown.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5926
Trusted
Western Indian Ocean: East Africa to Madagascar, Comores, Réunion, Mauritius, Rodrigues (Mascarenes), Aldabra, Farquhar Islands, Seychelles and Chagos Archipelago.
Trusted
Physical Description
Morphology
Dorsal spines (total): 12; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 5
-
Eschmeyer, W.N. 1986 Scorpaenidae. p. 463-478. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4313)
http://www.fishbase.org/references/FBRefSummary.php?id=4313&speccode=6383
Trusted
Size
Max. size
21.0 cm SL (male/unsexed; (Ref. 3503))
-
Poss, S.G. and K.V. Rama Rao 1984 Scorpaenidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 4. FAO, Rome. pag. var. (Ref. 3503)
http://www.fishbase.org/references/FBRefSummary.php?id=3503&speccode=6383
Trusted
Diagnostic Description
A black spot nearly as large as eye on inner surface of pectoral fins near base of first 5 rays; no black mark inside mouth at front of upper jaw. Ascending process of premaxilla narrow, its maximum width 1.8-2.2 in orbit diameter; a series of papillae or nodules (sometimes on a low ridge) across interorbital space between supraocular spines; nasal spine single (Ref 42181).
-
Eschmeyer, W.N. 1986 Scorpaenidae. p. 463-478. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4313)
http://www.fishbase.org/references/FBRefSummary.php?id=4313&speccode=6383
Trusted
Description
Usually found immobile at the bottom camouflaged among rocks and coral. Hunts by ambushing prey (Ref. 5503). Unlike most scorpaenids, the sting from the dorsal spines of this species can be painful but does not pose any real danger to the victim (Ref. 5503). Sold fresh in small quantities in markets.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Depth range based on 23 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0.15 - 150
Temperature range (°C): 24.782 - 27.698
Nitrate (umol/L): 0.050 - 0.279
Salinity (PPS): 34.984 - 35.429
Oxygen (ml/l): 4.660 - 4.806
Phosphate (umol/l): 0.108 - 0.207
Silicate (umol/l): 0.829 - 4.102
Graphical representation
Depth range (m): 0.15 - 150
Temperature range (°C): 24.782 - 27.698
Nitrate (umol/L): 0.050 - 0.279
Salinity (PPS): 34.984 - 35.429
Oxygen (ml/l): 4.660 - 4.806
Phosphate (umol/l): 0.108 - 0.207
Silicate (umol/l): 0.829 - 4.102
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0.15 - 150
Temperature range (°C): 24.782 - 27.698
Nitrate (umol/L): 0.050 - 0.279
Salinity (PPS): 34.984 - 35.429
Oxygen (ml/l): 4.660 - 4.806
Phosphate (umol/l): 0.108 - 0.207
Silicate (umol/l): 0.829 - 4.102
Graphical representation
Depth range (m): 0.15 - 150
Temperature range (°C): 24.782 - 27.698
Nitrate (umol/L): 0.050 - 0.279
Salinity (PPS): 34.984 - 35.429
Oxygen (ml/l): 4.660 - 4.806
Phosphate (umol/l): 0.108 - 0.207
Silicate (umol/l): 0.829 - 4.102
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Sluggish carnivore which lurks beneath coral heads and ledges on both interisland reef shallows and the seaward reef. It lies motionless while waiting for fish and invertebrates to venture close enough to capture (Ref. 275).
-
Hiatt, R.W. and D.W. Strasburg 1960 Ecological relationships of the fish fauna on coral reefs of the Marshall Islands. Ecol. Monogr. 30(1):65-127. (Ref. 275)
http://www.fishbase.org/references/FBRefSummary.php?id=275&speccode=4738
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Scorpaenopsis gibbosa
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CACCCTCTATTTAGTATTTGGTGCCTGAGCTGGAATGGTTGGAACAGCCCTGAGCCTGCTCATTCGAGCAGAACTAAGCCAACCCGGAGCCTTACTAGGTGACGACCAGATCTACAATGTAATTGTTACGGCACATGCCTTTGTAATGATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGAAACTGACTAATTCCATTAATAATTGGAGCCCCAGATATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCACCTTCCTTCCTCCTCCTGCTGGCCTCCTCAGGTGTTGAAGCCGGTGCTGGAACTGGTTGAACAGTCTACCCACCCCTGGCTGGCAACCTAGCCCATGCGGGAGCCTCAGTAGACCTAACAATCTTTTCGCTCCATTTGGCGGGGATTTCCTCAATTCTTGGTGCAATTAATTTCATCACTACAATTATTAATATGAAGCCCCCAGCAATCTCTCAATATCAGACACCCCTGTTTGTATGAGCCGTTTTGATTACTGCTGTTCTCCTTCTTCTTTCCCTTCCTGTCCTTGCTGCTGGCATTACAATGCTTTTAACAGACCGTAATCTTAATACCACTTTCTTTGATCCCGCAGGAGGAGGAGATCCTATCCTTTATCAACACCT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Scorpaenopsis gibbosa
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
-
Poss, S.G. and K.V. Rama Rao 1984 Scorpaenidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 4. FAO, Rome. pag. var. (Ref. 3503)
http://www.fishbase.org/references/FBRefSummary.php?id=3503&speccode=6383
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


