Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits still muddy habitats that are either deep or offshore (Ref. 48635) or shallow rocky and coral reefs (Ref. 9710). Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773). Minimum depth reported taken from Ref. 57178.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: East Africa, India, and Malaysia to the Moluccas, north to Taiwan, south to northern Australia. Single record from Fiji. Appears to be absent from oceanic islands of the Indian Ocean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: South Africa, East Africa and western Mascarenes east to Indonesia, Samoa and Tonga, north to Taiwan, south to Broome (Western Australia) and Loyalty Islands (New Caledonia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 13; Analspines: 0; Analsoft rays: 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 4113))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits shallow rocky and coral reefs (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First dorsal spine about the same length as the 2nd dorsal spine, with a large tuff of filaments. Ground color of head and body light-tan with narrow blackish brown streaks. All fins with blackish-brown spots. Illicium longer than next dorsal fin ray with small rounded to elongate esca (Ref. 48635). Attains 45 cm SL.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 90 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 2 - 84
  Temperature range (°C): 24.782 - 26.559
  Nitrate (umol/L): 0.134 - 2.844
  Salinity (PPS): 35.012 - 35.368
  Oxygen (ml/l): 4.133 - 4.753
  Phosphate (umol/l): 0.118 - 0.431
  Silicate (umol/l): 0.380 - 4.953

Graphical representation

Depth range (m): 2 - 84

Temperature range (°C): 24.782 - 26.559

Nitrate (umol/L): 0.134 - 2.844

Salinity (PPS): 35.012 - 35.368

Oxygen (ml/l): 4.133 - 4.753

Phosphate (umol/l): 0.118 - 0.431

Silicate (umol/l): 0.380 - 4.953
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 90m.
Recorded at 90 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits shallow rocky (Ref. 9710, 75154) and coral reefs (Ref. 9710), and in rocky regions with pebbles or sandy soil (Ref. 9137). A carnivore (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antennarius hispidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTTGTATTTGGAGCATGGGCCGGCATAGTAGGAACAGCACTTAGTCTACTAATCCGCGCAGAACTAAGCCAACCAGGCGCACTTTTAGGCGATGATCAAATCTATAATGTCATCGTTACAGCACATGCTTTTGTTATAATTTTCTTTATAGTCATGCCAATTATGATTGGAGGGTTTGGCAATTGATTGATTCCACTAATAATTGGCGCCCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTTTTACCCCCATCATTCCTTCTTTTACTAGCATCATCAGGGGTAGAAGCTGGAGCAGGCACAGGATGAACAGTCTACCCACCTCTTGCAAGCAACTTAGCCCATGCCGGAGCATCCGTTGATTTAACTATCTTCTCGCTTCACCTTGCAGGTGTATCATCCATCCTAGGGGCTATTAATTTTATTACAACCATTTTTAACATAAAACCCCCAGCCCTTTCACAATACCAAACACCCTTATTTGTATGAGCAGTGTTGGTCACTGCTGTACTTCTCCTCCTTTCCCTTCCTGTCCTTGCTGCAGGGATTACAATATTATTAACTGACCGAAACCTTAATACGACCTTCTTTGACCCTACTGGCGGAGGGGACCCTATTCTATACCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antennarius hispidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!