Overview

Comprehensive Description

Biology

Inhabits clear lagoon and seaward reefs (Ref. 9710). Benthopelagic over coral and rocks (Ref. 58302). Feeds on benthic invertebrates and small fishes (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is only known from the Hawaiian Islands Chain and Johnston Atoll, though possibly also found in other locations in the Pacific to the south and north west.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Central Pacific: Hawaiian Islands and Johnston Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central Pacific: Johnston Atoll and Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 430 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

39.5 cm TL (male/unsexed; (Ref. 26145))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Julis verticalis
Catalog Number: USNM 26829
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1880
Locality: Johnston'S Island, Johnston Atoll, United States Minor Outlying Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The main habitat is coral reefs, especially clear lagoon and seaward reefs (Lieske and Myers 1994, Mundy 2005) to depths of 60 m. It is also found over rocky reefs.

The initial phase fish (juveniles and possibly females) are a uniform greenish colour, and the terminal phase fish (probably males) are a uniformly patterned greenish grey. The diet includes benthic invertebrates and also small teleost fishes (Lieske and Myers 1994). The eggs and larvae are probably pelagic.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 60 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 1.0675 - 4.575
  Temperature range (°C): 24.549 - 28.049
  Nitrate (umol/L): 0.066 - 1.204
  Salinity (PPS): 34.625 - 35.294
  Oxygen (ml/l): 4.605 - 4.835
  Phosphate (umol/l): 0.092 - 0.351
  Silicate (umol/l): 1.414 - 1.498

Graphical representation

Depth range (m): 1.0675 - 4.575

Temperature range (°C): 24.549 - 28.049

Nitrate (umol/L): 0.066 - 1.204

Salinity (PPS): 34.625 - 35.294

Oxygen (ml/l): 4.605 - 4.835

Phosphate (umol/l): 0.092 - 0.351

Silicate (umol/l): 1.414 - 1.498
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma ballieui

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTTTATCTTGTGTTCGGCGCATGAGCCGGGATAGTAGGGACAGCCTTAAGCCTACTTATTCGAGCGGAGCTCAGCCAACCCGGCGCCCTTCTTGGGGAC---GATCAAATTTATAACGTGATCGTAACAGCCCACGCATTCGTCATAATCTTCTTTATAGTAATACCGATTATGATTGGAGGCTTTGGGAACTGACTCATCCCCCTAATAATTGGAGCGCCCGATATGGCCTTCCCTCGAATGAACAACATGAGCTTCTGACTTCTCCCCCCTTCCTTCTTACTTCTTCTCGCCTCCTCTGGCGTTGAAGCAGGAGCTGGAACTGGGTGAACAGTCTACCCGCCCCTGGCAGGCAACCTCGCCCATGCCGGCGCATCCGTCGATCTCACAATTTTTTCCCTACACTTGGCAGGGATCTCATCAATTCTGGGCGCAATCAACTTTATCACAACTATTATTAACATAAAACCCCCGGCCATTTCCCAATACCAGACACCTCTGTTCGTGTGAGCTGTCCTAATTACAGCAGTCCTACTACTTCTCTCCCTTCCTGTCCTTGCTGCTGGCATTACAATGCTCCTAACGGACCGAAACTTAAACACCACTTTCTTTGACCCGGCCGGAGGGGGAGACCCAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma ballieui

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pollard, D. & Cabanban, A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is known from the Hawaiian islands, where it is abundant. There are no known major threats, and it is largely protected in a major MPA in the northern part of its distribution. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Nothing is known about the status of its population. This species is abundant in surge zones in Hawaii.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species, although it is caught by subsistence and recreational fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures. However, at least 80% of this species range is included in the Northwestern Hawaiian Islands National Marine Sanctuary.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thalassoma ballieui

The blacktail wrasse, Thalassoma ballieui, is a species of wrasse native to the waters around the Hawaiian Islands and Johnston Island. It is a reef dweller found at depths from 1 to 60 m (3.3 to 200 ft). It can reach 39.5 cm (15.6 in) in length. It can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Pollard, D. & Cabanban, A. 2010. Thalassoma ballieui. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma ballieui" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!