Overview

Comprehensive Description

Biology

Occur in clear lagoon and seaward reefs (Ref. 9710). Benthopelagic over coral, rock and rubble (Ref. 58302). Feed mainly on benthic animals. Juveniles and adults sometimes act as cleaners (Ref. 9710). Spawning occur either in aggregations by fish in the initial color phase or in pairs, typically with the terminal male being much larger than the female.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Hawaiin Islands and Johnston Atoll (Randall et al. 1985, Barry and Hawryshyn 1999, Mundy 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Central Pacific: Johnston (Ref. 11013) and Hawaiian islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central Pacific: Johnston Atoll and Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 280 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

28.0 cm TL (male/unsexed; (Ref. 3921))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Julis clepsydralis
Catalog Number: USNM 26826
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1880
Locality: Johnston'S Island, Johnston Atoll, United States Minor Outlying Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reef-associated and inhabits rocky, coral and seaward reefs (Lieske and Myers 1994) to depths of at least 21 m. It feeds mainly on benthic crustaceans. It has been reported to act as cleaner by cleaning the ectoparasites of other fishes (Randall et al. 1985).

It exhibits protogynous hermaphroditism (Ross 1984), lives in sexually integrated, overlapping home ranges and mates promiscuously rather than in a harem (Ross et al. 1983). Sex change is socially controlled , induced by the presence of smaller conspecifics and inhibited by the presence of larger conspecifics (Ross et al. 1983, Ross 1987, Ross et al. 1990).

Spawning occurs either in aggregations or pairs (Sancho et al. 2000). In 1986, Victor found that the duration of the larval phase was 89.2 days. Minimum population doubling time of this species is less than 15 months (Froese and Pauly 2008) and maximum size was recorded at 28 cm TL (Randall 1985).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - ? m (Ref. 58302), usually 5 - 25 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 1.0675 - 4.575
  Temperature range (°C): 24.549 - 28.049
  Nitrate (umol/L): 0.066 - 1.204
  Salinity (PPS): 34.625 - 35.294
  Oxygen (ml/l): 4.605 - 4.835
  Phosphate (umol/l): 0.092 - 0.351
  Silicate (umol/l): 1.414 - 1.498

Graphical representation

Depth range (m): 1.0675 - 4.575

Temperature range (°C): 24.549 - 28.049

Nitrate (umol/L): 0.066 - 1.204

Salinity (PPS): 34.625 - 35.294

Oxygen (ml/l): 4.605 - 4.835

Phosphate (umol/l): 0.092 - 0.351

Silicate (umol/l): 1.414 - 1.498
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner. Sex reversal is completed in 8-12 weeks (Ref. 34185, 34261). Also Ref. 38856, 38703. Primary males participate in group spawning and have large testes; secondary males engage in pair-spawning and have smaller, reduced testes (Ref. 48503).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassoma duperrey

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Thalassoma duperrey

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CATAAAGATATTGGCACCCTCTATCTTGTATTCGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGAGCAGAGTTAAGCCAGCCCGGCGCCCTCCTTGGGGAC---GACCAGATCTATAAGGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAATATAAGCTTTTGACTTCTTCCCCCCTCATTCCTGCTTCTTCTTGCCTCTTCTGGTGTTGAGGCGGGGGCCGGAACCGGATGGACAGTCTACCCACCCTTAGCAGGTAACCTTGCCCACGCTGGTGCATCCGTTGACCTAACTATCTTCTCACTACATCTGGCAGGTGTTTCATCAATTCTAGGTGCAATTAATTTCATTACAACCATTATTAATATGAAACCCCCAGCCATCTCTCAATACCAAACACCCCTTTTCGTATGAGCCGTTCTAATTACAGCAGTCCTTCTCCTCCTTTCCCTTCCAGTACTTGCTGCCGGCATTACAATGCTCCTCACAGACCGAAACCTAAACACTACCTTCTTCGACCCTGCCGGGGGAGGAGACCCAATTCTTTACCAACATCTCTTCTGATTTTTTGGTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S., Liu, M. & Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is abundant throughout the Hawaiian Archipelago. There are no known major threats for this species. Although it is occasionally targeted for marine aquarium trade in Hawaii, it does not appear to be overexploited. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no data on total numbers of this fish, but this species has been noted as abundant throughout the Hawaiian Archipelago (Ross 1984).

This species hybridizes with T. lutescens at Johnston Atoll (Rocha pers. comm. 2008).

The frequency of occurrence at 44 locations in the Hawaiian Islands was 95.4% (Brainard et al. 2002). In 1993, 1994 and 1999, it was recorded as one of the top ten most dominant species numerically and with 100% occurrence in 24 sites during the surveys in Hanalei Bay, Hawaii (Jokiel and Brown 2000).

In Coconut Island, density has been recorded with 3 +/- 0.64 individuals per 300 m2. It is a dominant fish species in Kahekili reef with density varying from approximately 26.7 +/- 2.1 individuals per 250 m2 in 1994 to approximately 37.29 +/- 3.9 individuals per 250 m2 in 1997, in addition, short term total fish abundance increases up to 79.4 individuals per 50 m2 when people were feeding the fishes (Hultquist 1997).

This species is noted as an abundant species in Kaloko-Honokohau National Historical Park (University of Hawai’I at Manoa) and more than 7,000 individuals have been recorded within the lagoon at Midway from 1981 to 1985 (Schroeder and Parrish 2006).

Biomass of 0.293 kg per 100 m2 and mean density of 17 individuals per 100 m2 were recorded at Kure Atoll and noted as the top twenty most abundant species at Kure Atoll (Walsh et al. 2002).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is occasionally collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range. At least 70% of its range lies within the Papahanaumokuakea Marine National Monument, in the northwest Hawaiian Islands.

It was observed in Papawai and Red Hill South, a fishery management area where collection of aquarium fishes has been prohibited since 1991 (Tissot and Hallacher 2003) and it is present in the Kaloko-Honokohau National Historical Park which is currently managed by the State of Hawaii (National Park Service, U.S. Department of the Interior 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma duperrey

The saddle wrasse, Thalassoma duperrey, is a species of wrasse native to the waters around the Hawaiian Islands and Johnston Island. They are found on reefs at depths from 5 to 25 m (16 to 82 ft). This species can reach 28 cm (11 in) in total length. This species can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Shea, S., Liu, M. & Sadovy, Y. 2010. Thalassoma duperrey. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma duperrey" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!