Overview

Comprehensive Description

Study Material - G. moringa : DZUFRJ 2872, 2873, 2874, 2875, 2876; seven specimens; preanal myomeres 66-74; predorsal myomeres 52-61; LVBV myomeres 60- 72; total myomeres 137-139; 21.5-56.0 mm SL.

  • Marcia Salustiano de Castro, Ana Cristina Teixeira Bonecker (2005): Leptocephali collected off the eastern coast of Brazil (12 ° – 23 ° S). Zootaxa 935, 1-28: 18-18, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:3EA0A64C-D816-4404-8602-B8A4A37D170E
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A benthic and solitary species (Ref. 26340) abundant in shallow rocky and grassy areas and on coral reefs; less common in turbid bays or harbors. Its bite is very dangerous (Ref. 5217). Active during the day, sometimes together with other predators. Feeds on fish and crustaceans (Ref. 42064). Marketed fresh and salted (Ref. 5217). Usually seen with its head protruding from a hole and the rest of its body concealed (Ref. 26938). Has been traded as aquarium fish at Ceará, Brazil (Ref. 49392).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: from North Carolina, USA and Bermuda to Brazil, including the Gulf of Mexico, the Caribbean to southeastern Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina, USA and Bermuda to Brazil, including the Gulf of Mexico, the Caribbean to southeastern Brazil. Eastern Atlantic: Ascension and St. Helena (Ref. 4450). Mid- and eastern Atlantic islands (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 57911)); max. published weight: 2,510 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Moderate-size moray with a pattern of distinct small, round, overlapping dark brownish to purplish-black spots on white or pale yellow background (Ref. 26938).
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Lycodontis albimentis Evermann & Marsh
Catalog Number: USNM 49527
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration; Radiograph
Year Collected: 1899
Locality: Off Culebra Is., Culebritas Light-House, NE. 5 1/4 Miles, Puerto Rico, Greater Antilles, Caribbean Sea, Atlantic
Depth (m): 27 to 27
Vessel: Fish Hawk
  • Type: Evermann, B. W. & Marsh, M. C. 1902. Bulletin of the United States Fish Commission. 20 (for 1900): 78, fig. 9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 200 m (Ref. 9710), usually 0 - 35 m (Ref. 40849)
  • Gasparini, J.L. and S.R. Floeter 2001 The shore fishes of Trindade Island, western South Atlantic. J. Nat. Hist. 35:1639-1656. (Ref. 40849)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 279 specimens in 1 taxon.
Water temperature and chemistry ranges based on 204 samples.

Environmental ranges
  Depth range (m): 0.1 - 1690
  Temperature range (°C): 4.038 - 28.503
  Nitrate (umol/L): 0.122 - 20.044
  Salinity (PPS): 34.217 - 37.172
  Oxygen (ml/l): 3.609 - 5.961
  Phosphate (umol/l): 0.006 - 1.246
  Silicate (umol/l): 0.799 - 13.700

Graphical representation

Depth range (m): 0.1 - 1690

Temperature range (°C): 4.038 - 28.503

Nitrate (umol/L): 0.122 - 20.044

Salinity (PPS): 34.217 - 37.172

Oxygen (ml/l): 3.609 - 5.961

Phosphate (umol/l): 0.006 - 1.246

Silicate (umol/l): 0.799 - 13.700
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A benthic and solitary species (Ref. 26340) abundant in shallow rocky and grassy areas and on coral reefs; less common in turbid bays or harbors. It's bite is very dangerous (Ref. 5217). Cleaned by Pederson's cleaner shrimp (Periclimenes pedersoni) and goby (Gobiosoma evelynae and others) as observed on the coral reefs in Bonaire, Netherlands Antilles (Ref. 36810). Also Ref. 58534.
  • Randall, J.E. 1967 Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847. (Ref. 33)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawning migrations, leptocephalus larvae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax moringa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAGTATTTGGTGCTTGAGCCGGGATGGTCGGCACCGCGTTGAGCCTGCTTATCCGTGCTGAACTTAGCCAGCCAGGTGCTCTCCTAGGTGACGACCAGATTTACAATGTTATTGTAACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAGTCATGATCGGAGGGTTTGGAAACTGACTTATCCCACTAATAATTGGAGCCCCTGACATAGCATTCCCGCGAATAAATAATATGAGCTTCTGACTGCTCCCTCCTTCATTCCTCCTACTACTAGCCTCATCAGGCGTAGAGGCTGGAGCAGGGACCGGGTGGACTGTTTATCCGCCCCTTGCAGGAAATCTGGCCCATGCCGGAGCATCCGTTGATTTAACTATTTTTTCTCTTCATCTAGCAGGTGTGTCTTCAATCTTAGGGGCAATTAACTTCATCACAACCATTATTAACATGAAACCCCCAGCCATTACACAATATCAGACACCACTATTTGTATGAGCGGTGCTCGTTACAGCTGTCCTTTTATTACTCTCTTTACCTGTGCTGGCGGCTGGTATTACAATGCTTTTAACCGATCGAAACCTCAATACAACTTTCTTTGACCCCGCCGGAGGAGGTGATCCAATCCTCTATCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax moringa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 7 specimens with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo and Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted moray

The spotted moray (Gymnothorax moringa) is a medium to large moray eel. It has a long snake-like body, white or pale yellow in color with small overlapping dark-brown spots. Typical length is around 60 centimeters, but recent specimens suggest to maximum size of this moray is almost 7 feet, or two meters (200 centimeters).[1]

The spotted moray is found in the Western Atlantic Ocean from North Carolina and Bermuda to Brazil, including the Gulf of Mexico and the Caribbean. It is also found around Mid- and Eastern Atlantic islands as far south as St Helena. It is found from near to the surface, up to a depth of 200 meters.

Spotted morays are solitary animals, and are usually seen in holes, with only the head protruding. They are active during the day, feeding at the sea bottom on crustaceans and other fish. Their bite can be dangerous to humans. There is a minor fishery for them, and they have even been kept as aquarium fish, though they grow too large for this to be practicable in most circumstances.

Notes[edit]

  1. ^ "Gymnothorax moringa, Spotted moray : fisheries, aquarium". Fishbase.org.cn. Retrieved 2011-04-14. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!