Overview

Comprehensive Description

Biology

Occurs on continental and insular shelves and oceanic waters adjacent to them (Ref. 244). Common on coral reefs, often in deeper areas near drop-offs to the open sea, in atoll passes, and in shallow lagoons adjacent to areas of strong currents (Ref. 244). Coastal-pelagic near the bottom, near drop-offs at 1-275 m (Ref. 58302). Forms daytime schools or aggregations in favored areas (Ref. 244). Although active during the day, it is more active nocturnally (Ref. 244). Viviparous, with 1-6 pups (Ref. 37816). Feeds on reef fishes, squids, octopi, crabs, lobsters and shrimps (Ref. 244, 5578). Tends to be aggressive under baited conditions (Ref. 6871) and readily enters into a frenzy feeding pattern, at which time it may become quite dangerous. Repeatedly incriminated in human attacks. Utilized for human consumption, fishmeal, and other shark products. Minimum depth from Ref. 6871. Maximum length of female taken from Ref. 5213.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Madagascar and the Mauritius-Seychelles area, possibly India; also Red Sea to South Africa if Carcharhinus wheeleri is synonymized with this species. In the Pacific, it ranges from southern China to northern Australia and the Tuamoto Archipelago.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Grey Reef Shark is a widespread species occurring in the central Pacific and westwards to the eastern Indian Ocean. Garrick (1982) notes his most eastern records of this species from Tuamoto Archipelago in the south and the Hawaiian Islands in the north, west through the Pacific, northern coast of Australia, Indonesia, Sumatra and west to Madagascar in the Indian Ocean, including the Seychelles and Reunion (see Compagno 1984 and Last and Stevens 1994 for maps).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The grey reef shark occupies a widespread range from the eastern Pacific Ocean (Costa Rica) through the western Pacific and Indian Oceans, and in the Red Sea. Grey reef sharks are most commonly encountered off the islands of Tahiti, Micronesia, Fiji, Papua New Guinea, and Malaysia.

Biogeographic Regions: indian ocean; pacific ocean

  • Murphy, G. 1993. Grey Reef Shark. Skin Diver, v42 n11: 138.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cargados Carajos, Chagos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and western Mascarenes east to Marquesas Islands and Easter Island, north to South China Sea and Hawaiian Islands, south to Lord Howe Island,Norfolk Island and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Grey reef sharks have sleek, fusiform bodies that are unmistakable for anything but a shark. Key physical features include the anal fin, five gill slits, and a mouth positioned behind the eyes and underneath the snout. Additionally, grey reef sharks appear grey from a distance, but show a bronze tint when viewed up close. They have a white underside and are distinguished by a broad black band on the edge of the tail and black markings on the tips of the pectoral fins. The dorsal fin is either grey or tipped white. They have a long, broadly rounded snout and round eyes. They are lacking an interdorsal fin.

Males grow up to 255 cm in length, and are 130-145 cm long at maturity, while females are a bit smaller, maturing at 120-135 cm, with a record length of 172 cm. Males are distinguished by the elongate mating claspers on their pelvic fins. The maximum published weight for an individual of this species is 33.7 kg, but large males may be heavier.

Grey reef sharks can be easily mistaken for similar species of requiem sharks. The blacktip shark (Carcharhinus limbatus) and the blacktip reef shark (Carcharhinus melanopterus) can be distinguised by a black tip on the dorsal fin, while the dorsal fin of C. amblyrhynchos is white or grey. Similarly, the silvertip shark (Carcharhinus albimarginatus) has white tips on its pectoral and caudal fins, while C. amblyrhynchos does not.

Range length: 122 to 255 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 18535 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2550 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

255 cm TL (male/unsexed; (Ref. 2334)); 172 cm TL (female); max. published weight: 33.7 kg (Ref. 4699); max. reported age: 25 years (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark grey or bronze-grey above, white below; caudal fin with a conspicuous wide black posterior margin; undersides of pectoral and pelvic fins with black tips and posterior margins, but fins otherwise not conspicuously black or white-tipped except for white-tipped first dorsal in some individuals (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Abundant in lagoons of coral islands, often in deeper areas near drop-offs. Frequently found in large groups, may become very aggressive if food is in the water. Feeds on reef bony fishes, squid, octopi, crabs, lobsters and shrimp. Viviparous. More active nocturnally. Readily enters into a frenzy feeding pattern, at which time it may become quite dangerous. Repeatedly incriminated in human attacks. Shows microhabitat separation from the blacktip reef shark.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type; Holotype for Carcharhinus amblyrhynchos
Catalog Number: USNM 50860
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown; Illustration
Year Collected: 1902
Locality: Hawaii, French Frigate Shoals, French Frigate Shoals, Northwestern Hawaiian Islands, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
  • Type: Snyder, J. O. 1904. Bulletin of the United States Fish Commission. 22 (for 1902): 514, fig. 2; pl. 1.; Howe, J. C. & Springer, V. G. 1993. Smithsonian Contributions to Zoology. No. 540: 9.; Holotype: Snyder, J. O. 1904. Bulletin of the United States Fish Commission. 22 (for 1902): 514, fig. 2; pl. 1.; Howe, J. C. & Springer, V. G. 1993. Smithsonian Contributions to Zoology. No. 540: 9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 0 - 1000 m (Ref. 55178), usually 0 - 280 m (Ref. 6871)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species is found in clear tropical waters often from 10 m to more than 50 m around coral reefs, particularly near drop-offs and passes of fringing reefs. It is more common at ancient atolls, and less common at high profile islands with extensive human habitation, or in turbid continental waters (Randall 1986, Wetherbee et al. 1997). At unexploited sites Grey Reef Sharks are one of the most common tropical reef sharks that may be found in groups or individually. Potentially dangerous when harassed, they have been shown to display stereotypical threats (Johnson and Nelson 1973, Nelson 1981, Randall 1986). Divers are advised to keep their distance and not take strobe photographs when sharks display erratic swimming.

Males mature at 120?140 cm total length (TL) and attain a size of 185 cm; females mature at about 125 cm TL and attain 190 cm (Wetherbee et al. 1997) at about seven years. Litters are small, up to six embryos (Compagno 1984b, Last and Stevens 1994, Wetherbee et al. 1997). Seasonality is uncertain because of limited data. Parturition may be in August with a nine month gestation possible in the southern hemisphere (Stevens and McLoughlin 1991). Mating and fertilisation take place in March?May (or July). Pupping appears to occur from March to July off Hawaii, suggesting a 12 month gestation, but females reproduce every other year (Wetherbee et al. 1997). Fishes form the bulk of the prey while squids, octopuses and crustaceans are less important food items (Salini et al. 1992, Wetherbee et al. 1997).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species can be found near the surface of tropical oceans and as deep as 280 m. It is common on coral reefs and areas near drop-offs into deeper water.

Range depth: 0 to 280 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic ; reef ; coastal

  • Compagno, L. 1984. Sharks of the World. Rome: United Nations Development Programme.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 103 specimens in 1 taxon.
Water temperature and chemistry ranges based on 79 samples.

Environmental ranges
  Depth range (m): 9 - 83
  Temperature range (°C): 24.169 - 29.115
  Nitrate (umol/L): 0.057 - 3.148
  Salinity (PPS): 34.411 - 35.470
  Oxygen (ml/l): 4.005 - 4.742
  Phosphate (umol/l): 0.083 - 0.412
  Silicate (umol/l): 0.567 - 7.439

Graphical representation

Depth range (m): 9 - 83

Temperature range (°C): 24.169 - 29.115

Nitrate (umol/L): 0.057 - 3.148

Salinity (PPS): 34.411 - 35.470

Oxygen (ml/l): 4.005 - 4.742

Phosphate (umol/l): 0.083 - 0.412

Silicate (umol/l): 0.567 - 7.439
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 280m.
Recorded at 280 meters.

Habitat: reef-associated. Grey reef shark.  (Bleeker, 1856)  Attains 2.55 m. Colour greyish brown to bronzy, shading to white ventrally. Easily identified by the broad black trailing edge of the caudal fin. Other fins have no distinct white or dark markings. Litter of 3-6 pups, born at 60 cm; mature at 130-140 cm. A common inhabitant of coral reefs from the eastern Indian Ocean and Red Sea eastward to Hawaii and Pitcairn Island. Feeds mainly on small fish and other animals. Common on upper part of outer reef slopes. Can be aggressive and may be dangerous. Wounds that are inflicted are often the result of divers not heeding the shark's threat posturs; generally there is just one warning slashing bite without the intent to feed. Sometimes misidentified as C. menisorrah a synonym of C. falciformis. Carcharhinus wheeleri was previously misidentified as C.ablyrhynchos.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits tropical waters except regions with coral reefs (Ref. 9137). Occurs on the continental shelf (Ref. 75154). A carnivor (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The primary diet of C. amblyrhynchos is bony reef fishes less than 30 cm long. It also eats squid, octopi, crabs, lobsters, and shrimp. These sharks catch their food with their jaws and sharp teeth. When hunting, grey reef sharks have been observed swimming at speeds of up to 30 mph (48 km/h).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Grey reef sharks are usually the top predators on coral reefs, controlling the fish populations under them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The risk of predation on Carcharhinus amblyrhynchos decreases as it grows, but some are still prey to larger sharks and Orca whales. Predation has been noted in the Marshall Islands by Carcharhinus albimarginatus.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Carcharhinus amblyrhynchos perceives its environment very much through its excellent sense of smell. It can detect very low concentrations of blood by swinging its head side to side and using both nostrils to sample the water. All of its senses are acute. Its vision is sensitive to blue-green and low light because there are many rod cells in the retina. These sharks are generally thought to be far-sighted, but they can hunt by starlight. Grey reef sharks "hear" by detecting sounds through vibrations using sensory pits called the lateral line system. They have inner-ear semicircular canals used for balance, motion, and vibration. Most unique is its electromagnetic sense. This is facilitated by pores known as "ampullae of Lorenzini" that are concentrated around the snout. As sharks move through the earth's magnetic field, they create an electric field. By sensing this field, they can detect the strength and direction of it. This is the grey reef shark's navigation system.

These sharks communicate with other sharks visually (see the Behavior section for details of their territorial defense display) and by touch (see Mating Systems).

Communication Channels: visual ; tactile ; acoustic ; chemical ; electric

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical ; electric ; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Viviparous, placental (Ref. 50449). 1-6 pups in a litter (Ref. 244). Gestation period about 12 months (Ref. 244). Size at birth 50 to 60 cm (Ref. 26346, 37816) or 75 cm (Ref. 244). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

The species is viviparous, meaning that its embryos are connected to a placenta-like yolk sac, and the young are born alive and free-swimming, not in an egg. Females give birth to live young, usually sized between 46 and 60 cm. Males mature at a length of 130-145 cm, and females at 122-137 cm.

  • Perrine, D. 1995. Sharks. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest known lifespan for a wild grey reef shark is 25 years, but we don't have much information on how long this species can live.

Range lifespan

Status: wild:
25 (high) years.

Average lifespan

Status: captivity:
25 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Carcharhinus amblyrhynchos mate through internal fertilization. When a female is ready to mate, she will give off behavioral and chemical cues (pheromones). When the male senses these cues, he pursues her and seizes her with his teeth, which can actually cause serious wounds. Females have thicker skin on their backs than males do, probably to protect them from male biting.

We have no information on the seasonality of mating in this species, or how many mates males or females have when breeding.

As in all sharks, male gray reef sharks have paired reproductive structures called "claspers," located between the pelvic fins. A groove in each clasper directs sperm into the female's cloaca during mating. Sperm may fertilize the egg then, or may be stored until an egg is released.

Females produce 1-6 offspring at a time, and the embryos gestate for about 12 months before birth.

Gray reef sharks mature at 7-7.5 years of age.

Range number of offspring: 1 to 6.

Average gestation period: 12 months.

Range age at sexual or reproductive maturity (female): 7 to 7.5 years.

Range age at sexual or reproductive maturity (male): 7 to 7.5 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous ; sperm-storing

Carcharhinus amblyrhynchos females nourish their offspring while they are still inside them, but once the babies are born they are left to feed and protect themselves.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Compagno, L. 1984. Sharks of the World. Rome: United Nations Development Programme.
  • Perrine, D. 1995. Sharks. Stillwater, MN: Voyageur Press.
  • Murphy, G. 1993. Grey Reef Shark. Skin Diver, v42 n11: 138.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus amblyrhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGTATAGTNGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGGGATGATCAGATTTATAATGTAATCGTAACTGCCCACGCTTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTTCCTTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTTTGACTTCTTCCACCATCATTTCTTCTCCTCCTCGCTTCTGCCGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTTTATCCCCCATTAGCTAGTAACCTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATTCTAGCTTCAATTAATTTTATTACAACTATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCTTATCACTTCCAGTTCTTGCAGCAGGGATTACAATATTACTTACAGATCGTAACCTTAATACTACATTCTTTGATCCTGCAGGTGGAGGAGATCCAATCCTTTATCAACATTTATTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus amblyrhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Specimens with Barcodes: 59
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Smale, M.J.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Grey Reef Shark (Carcharhinus amblyrhynchos) is a widespread, social species that formerly was common in clear, tropical, coastal waters and oceanic atolls. Its restricted habitat, site fidelity, inshore distribution, small litter size, and relatively late age at maturity, along with increasing fishing pressure suggests that this species may be under threat. Although caught in tropical multi-species fisheries, it has considerably greater value in dive tourism if protected. With time and additional data, this Near Threatened assessment may need to be revised.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

While the grey reef shark has not been identified as endangered as of yet, depletion of the species has been noticed around the Maldive Islands, and may be occurring in other parts of its range. There are several aspects of the biology and behavior of this species that make it particularly vulnerable to over-fishing. It is found relatively near shore, individuals tend to stay in one area, and they gather in predictable locations, making them easier to catch. Females matures relatively slowly, and have small litters, which means slower population growth compared to other large fish.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This shark has been recorded as locally highly abundant at some sites. Some local populations have been severely depleted.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This shark shows high site fidelity and some local populations have been severely depleted by modest fishing pressure, as has been shown off Hawaii (Wetherbee et al. 1997). Very marked declines of sharks, including Grey Reef Sharks, have been reported in the Chagos Archipelago (Indian Ocean) between the 1970s and 1996. Shark numbers here were reduced to only 14% of the numbers found in the 1970s (Anderson et al. 1998). The quality of its coral reef habitat is threatened in many parts of the world.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Smith et al. (1998) found this species to have moderate rebound potential, so it should respond positively to effective management measures. Because Grey Reef Sharks are found in clear tropical waters over coral reefs, they are ideal for non-consumptive (but much more lucrative) use in the form of tourism diving, as has been shown by Anderson and Ahmed (1993). For this reason, shark populations at some of the most important reef diving sites in the Maldives are now protected.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Although usually considered harmless, C. amblyrhynchos may occasionally bite humans. The bites are serious, but rarely fatal. Accidents most often occur during spearfishing, when the sharks become aggressive in the presence of food. Careless divers who corner the animal in a reef canyon may also be attacked in self-defense. Additionally, there are areas of eastern Micronesia, particularly the Marshall Islands, where these sharks have a reputation for being aggressive toward humans.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Since grey reef sharks are generally a harmless and inquisitive species, studies are conducted on them quite easily. Ecotourism in the form of "shark diving" has also recently blossomed into a large industry.

Positive Impacts: ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey reef shark

The grey reef shark (Carcharhinus amblyrhynchos, sometimes misspelled amblyrhynchus or amblyrhinchos)[2] is a species of requiem shark, family Carcharhinidae. One of the most common reef sharks in the Indo-Pacific, it is found as far east as Easter Island and as far west as South Africa. This species is most often seen in shallow water near the drop-offs of coral reefs. The grey reef shark has the typical "reef shark" shape, with a broad, round snout and large eyes. This species can be distinguished from similar species by the plain or white-tipped first dorsal fin, the dark tips on the other fins, the broad, black rear margin on the tail fin, and the lack of a ridge between the dorsal fins. Most individuals are less than 1.9 m (6.2 ft) long.

Grey reef sharks are fast-swimming, agile predators that feed primarily on free-swimming bony fishes and cephalopods. Their aggressive demeanor enables them to dominate many other shark species on the reef, despite their moderate size. Many grey reef sharks have a home range on a specific area of the reef, to which they continually return. However, they are social rather than territorial. During the day, these sharks often form groups of five to 20 individuals near coral reef drop-offs, splitting up in the evening as the sharks begin to hunt. Adult females also form groups in very shallow water, where the higher water temperature may accelerate their growth or that of their unborn young. Like other members of its family, the grey reef shark is viviparous, meaning the mother nourishes her embryos through a placental connection. Litters of one to six pups are born every other year.

Grey reef sharks were the first shark species known to perform a threat display, a stereotypical behavior warning that it is prepared to attack.[3] The display involves a "hunched" posture with characteristically dropped pectoral fins, and an exaggerated, side-to-side swimming motion. Grey reef sharks often do so if they are followed or cornered by divers to indicate they perceive a threat. This species has been responsible for a number of attacks on humans, so should be treated with caution, especially if they begin to display. They are caught in many fisheries and are susceptible to local population depletion due to their low reproduction rate and limited dispersal. As a result, the International Union for Conservation of Nature has assessed this species as Near Threatened.

Contents

Taxonomy and phylogeny [edit]

Dutch ichthyologist Pieter Bleeker first described the grey reef shark in 1856 as Carcharias (Prionodon) amblyrhynchos, in the scientific journal Natuurkundig Tijdschrift voor Nederlandsch-Indië. Later authors moved this species to the genus Carcharhinus. The type specimen was a 1.5 m (4.9 ft)-long female from the Java Sea.[4] Other common names used for this shark around the world include black-vee whaler, bronze whaler, Fowler's whaler shark, graceful shark, graceful whaler shark, grey shark, grey whaler shark, longnose blacktail shark, school shark, and shortnose blacktail shark. Some of these names are also applied to other species.[2]

In older literature, the scientific name of this species was often given as C. menisorrah.[5] The blacktail reef shark (C. wheeleri), native to the western Indian Ocean, is now regarded as the same species as the grey reef shark by most authors. It was originally distinguished from the grey reef shark by a white tip on the first dorsal fin, a shorter snout, and one fewer upper tooth row on each side.[6] Based on morphological characters, vertebral counts, and tooth shapes, Garrick (1982) concluded the grey reef shark is most closely related to the silvertip shark (C. albimarginatus).[7] This interpretation was supported by a 1992 allozyme phylogenetic analysis by Lavery.[8]

Description [edit]

Identifying features of the grey reef shark include dark edges on all fins except for the first dorsal fin.

The grey reef shark has a streamlined, moderately stout body with a long, blunt snout and large, round eyes. There are 13–14 tooth rows on each side of both jaws (usually 14 in the upper and 13 in the lower). The upper teeth are triangular with slanted cusps, while the bottom teeth have narrower, erect cusps. The tooth serrations are larger in the upper jaw than in the lower. The first dorsal fin is medium-sized, and there is no ridge running between it and the second dorsal fin. The pectoral fins are narrow and falcate (sickle-shaped).[4]

The coloration is grey above, sometimes with a bronze sheen, and white below. The entire rear margin of the caudal fin has a distinctive, broad, black band. There are dusky to black tips on the pectoral, pelvic, second dorsal, and anal fins.[9] Individuals from the western Indian Ocean have a narrow, white margin at the tip of the first dorsal fin; this trait is usually absent from Pacific populations.[5] Grey reef sharks that spend time in shallow water eventually darken in color, due to tanning.[10] Most grey reef sharks are less than 1.9 m (6.2 ft) long.[4] The maximum reported length is 2.6 m (8.4 ft) and the maximum reported weight is 33.7 kg (74.3 lb).[9]

Distribution and habitat [edit]

Photo of shark swimming next to large, brightly colored coral head
Coral reef drop-offs are favored habitat for grey reef sharks.

The grey reef shark is native to the Indian and Pacific Oceans. In the Indian Ocean, it occurs from South Africa to India, including Madagascar and nearby islands, the Red Sea, and the Maldives. In the Pacific Ocean, it is found from southern China to northern Australia and New Zealand, including the Gulf of Thailand, the Philippines, and Indonesia.[4][9] This species has also been reported from numerous Pacific islands, including American Samoa, the Chagos Archipelago, Easter Island, Christmas Island, the Cook Islands, the Marquesas Islands, the Tuamotu Archipelago, Guam, Kiribati, the Marshall Islands, Micronesia, Nauru, New Caledonia, the Marianas Islands, Palau, the Pitcairn Islands, Samoa, the Solomon Islands, Tuvalu, the Hawaiian Islands, and Vanuatu.[1]

Generally a coastal, shallow-water species, grey reef sharks are mostly found in depths of less than 60 m (200 ft).[11] However, they have been known to dive to 1,000 m (3,300 ft).[2] They are found over continental and insular shelves, preferring the leeward (away from the direction of the current) sides of coral reefs with clear water and rugged topography. They are frequently found near the drop-offs at the outer edges of the reef, and less commonly within lagoons. On occasion, this shark may venture several kilometers out into the open ocean.[4][11]

Biology and ecology [edit]

Photo of long-finned shark, swimming
A female grey reef shark off Wake Island - this species is one of the most common sharks on Indo-Pacific reefs.

Along with the blacktip reef shark (C. melanopterus) and the whitetip reef shark (Triaenodon obesus), the grey reef shark is one of the three most common sharks inhabiting Indo-Pacific reefs. They actively expel most other shark species from favored habitats, even species larger in size.[3] In areas where this species co-exists with the blacktip reef shark, the latter species occupies the shallow flats, while the former stays in deeper water.[4] Areas with a high abundance of grey reef sharks tend to contain few sandbar sharks (C. plumbeus), and vice versa; this may be due to their similar diets causing competitive exclusion.[11]

On the infrequent occasions when they swim in oceanic waters, grey reef sharks often associate with marine mammals or large pelagic fishes, such as sailfish (Istiophorus platypterus). There is an account of around 25 grey reef sharks following a large pod of bottlenose dolphins (Tursiops sp.), along with 25 silky sharks (C. falciformis) and a single silvertip shark.[12] Rainbow runners (Elagatis bipinnulata) have been observed rubbing against grey reef sharks, using the sharks' rough skin to scrape off parasites.[13]

Grey reef sharks are prey for larger sharks, such as the silvertip shark.[9] At Rangiroa Atoll in French Polynesia, great hammerheads (Sphyrna mokarran) feed opportunistically on grey reef sharks that are exhausted from pursuing mates.[14] Known parasites of this species include the nematode Huffmanela lata and several copepod species that attach to the sharks' skin,[15][16] and juvenile stages of the isopods Gnathia trimaculata and G. grandilaris that attach to the gill filaments and septa (the dividers between each gill).[17][18]

Feeding [edit]

The lower teeth of the grey reef shark are narrower than upper teeth.

Grey reef sharks feed mainly on bony fishes, with cephalopods such as squid and octopus being the second-most important food group, and crustaceans such as crabs and lobsters making up the remainder. The larger sharks take a greater proportion of cephalopods.[19] These sharks hunt individually or in groups, and have been known to pin schools of fish against the outer walls of coral reefs for feeding.[13] They excel at capturing fish swimming in the open, and they complement hunting whitetip reef sharks, which are more adept at capturing fish inside caves and crevices.[4] Their sense of smell is extremely acute, being capable of detecting one part tuna extract in 10 billion parts of sea water.[12] In the presence of a large quantity of food, grey reef sharks may be roused into a feeding frenzy; in one documented frenzy caused by an underwater explosion that killed several snappers, one of the sharks involved was attacked and consumed by the others.[20]

Life history [edit]

During mating, the male grey reef shark will bite at the female's body or fins to hold onto her for copulation.[12] Like other requiem sharks, it is viviparous: once the developing embryos exhaust their supply of yolk, the yolk sac develops into a placental connection that sustains them to term. Each female has a single functional ovary (on the right side) and two functional uteruses. One to four pups (six in Hawaii) are born every other year; the number of young increases with female size. Estimates of the gestation period range from 9 to 14 months. Parturition is thought to take place from July to August in the Southern Hemisphere and from March to July in the Northern Hemisphere. However, females with "full-term embryos" have also been reported in the fall off Enewetak. The newborns measure 45–60 cm (16–24 in) long. Sexual maturation occurs at around seven years of age, when the males are 1.3–1.5 m (4.3–4.9 ft) long and females are 1.2–1.4 m (3.9–4.6 ft) long. Females on the Great Barrier Reef mature at 11 years of age, later than at other locations, and at a slightly larger size. The lifespan is at least 25 years.[4][19][21]

Behavior [edit]

Photo of shark in twilit waters with coral head in background
Grey reef sharks become more active as night approaches.

Grey reef sharks are active at all times of the day, with activity levels peaking at night.[4] At Rangiroa, groups of around 30 sharks spend the day together in a small part of their collective home range, dispersing at night into shallower water to forage for food. Their home range is about 0.8 km2 (0.31 sq mi).[22] At Enewetak in the Marshall Islands, grey reef sharks from different parts of the reef exhibit different social and ranging behaviors. Sharks on the outer ocean reefs tend to be nomadic, swimming long distances along the reef, while those around lagoon reefs and underwater pinnacles stay within defined daytime and night-time home ranges.[23] Where there are strong tidal currents, grey reef sharks move against the water: towards the shore with the ebbing tide and back out to sea with the rising tide. This may allow them to better detect the scent of their prey, or afford them the cover of turbid water in which to hunt.[22]

There is little evidence of territoriality in the grey reef shark; individuals will tolerate others of their species entering and feeding within their home ranges.[24] Off Hawaii, individuals may stay around the same part of the reef for up to three years,[25] while at Rangiroa, they regularly shift their locations by up to 15 km (9.3 mi).[24] Individual grey reef sharks at Enewetak become highly aggressive at specific locations, suggesting they may exhibit dominant behavior over other sharks in their home areas.[3]

Sociality [edit]

Photo of dozens of sharks swimming in shallow water over pink coral
Grey reef sharks often group together during the day, such as this aggregation at Jarvis Island.

Social aggregation is well documented in grey reef sharks. In the northwestern Hawaiian Islands, large numbers of pregnant adult females have been observed slowly swimming in circles in shallow water, occasionally exposing their dorsal fins or backs. These groups last from 11:00 to 15:00, corresponding to peak daylight hours.[25] Similarly, at Sand Island off Johnston Atoll, females form aggregations in shallow water from March to June. The number of sharks per group differs from year to year. Each day, the sharks begin arriving at the aggregation area at 09:00, reaching a peak in numbers during the hottest part of the day in the afternoon, and dispersing by 19:00. Individual sharks return to the aggregation site every one to six days. These female sharks are speculated to be taking advantage of the warmer water to speed their growth or that of their embryos. The shallow waters may also enable them to avoid unwanted attention by males.[10]

Off Enewetak, grey reef sharks exhibit different social behaviors on different parts of the reef. Sharks tend to be solitary on shallower reefs and pinnacles. Near reef drop-offs, loose aggregations of five to 20 sharks form in the morning and grow in number throughout the day before dispersing at night. In level areas, sharks form polarized schools (all swimming in the same direction) of around 30 individuals near the sea bottom, arranging themselves parallel to each other or slowly swimming in circles. Most individuals within polarized schools are females, and the formation of these schools has been theorized to relate to mating or pupping.[22][23]

Threat display [edit]

Drawings showing threatening and nonthreatening postures from front and side underlain with a line that is jagged and red on the left and gently curving and blue on the right
The posture of a grey reef shark during normal swimming (right) and a threat display (left) - the bottom line shows the shark's swimming pattern.

The "hunch" threat display of the grey reef shark is the most pronounced and well-known agonistic display (a display directed towards competitors or threats) of any shark. Investigations of this behavior have been focused on the reaction of sharks to approaching divers, some of which have culminated in attacks. The display consists of the shark raising its snout, dropping its pectoral fins, arching its back, and curving its body laterally. While holding this posture, the shark swims with a stiff, exaggerated side-to-side motion, sometimes combined with rolls or figure-8 loops. The intensity of the display increases if the shark is more closely approached or if obstacles are blocking its escape routes, such as landmarks or other sharks. If the diver persists, the shark will either retreat or launch a rapid open-mouthed attack, slashing with its upper teeth.[3]

Most observed displays by grey reef sharks have been in response to a diver (or submersible) approaching and following it from a few meters behind and above. They also perform the display towards moray eels, and in one instance towards a much larger great hammerhead (which subsequently withdrew). However, they have never been seen performing threat displays towards each other. This suggests the display is primarily a response to potential threats (i.e. predators) rather than competitors. As grey reef sharks are not territorial, they are speculated to be defending a critical volume of "personal space" around themselves. Compared to sharks from French Polynesia or Micronesia, grey reef sharks from the Indian Ocean and western Pacific are not as aggressive and less given to displaying.[3]

Human interactions [edit]

Grey reef sharks are often curious about divers when they first enter the water and may approach quite closely, though they lose interest on repeat dives.[4] They can become dangerous in the presence of food, and tend to be more aggressive if encountered in open water rather than on the reef.[12] There have been several known attacks on spearfishers, possibly by mistake, when the shark struck at the speared fish close to the diver. This species will also attack if pursued or cornered, and divers should immediately retreat (slowly and always facing the shark) if it begins to perform a threat display.[4] Photographing the display should not be attempted, as the flash from a camera is known to have incited at least one attack.[3] Although of modest size, they are capable of inflicting significant damage: during one study of the threat display, a grey reef shark attacked the researchers' submersible multiple times, leaving tooth marks in the plastic windows and biting off one of the propellers. The shark consistently launched its attacks from a distance of 6 m (20 ft), which it was able to cover in a third of a second.[13] As of 2008, the International Shark Attack File listed seven unprovoked and six provoked attacks (none of them fatal) attributable to this species.[26]

Although still abundant at Cocos Island and other relatively pristine sites, grey reef sharks are susceptible to localized depletion due to their slow reproductive rate, specific habitat requirements, and tendency to stay within a certain area. The IUCN has assessed the grey reef shark as Near Threatened; this shark is taken by multispecies fisheries in many parts of its range and used for various products such as shark fin soup and fishmeal.[2] Another threat is the continuing degradation of coral reefs from human development. There is evidence of substantial declines in some populations. Anderson et al.. (1998) reported, in the Chagos Archipelago, grey reef shark numbers in 1996 had fallen to 14% of 1970s levels.[27] Robbins et al.. (2006) found grey reef shark populations in Great Barrier Reef fishing zones had declined by 97% compared to no-entry zones (boats are not allowed). In addition, no-take zones (boats are allowed but fishing is prohibited) had the same levels of depletion as fishing zones, illustrating the severe effect of poaching. Projections suggested the shark population would fall to 0.1% of pre-exploitation levels within 20 years without additional conservation measures.[28] One possible avenue for conservation is ecotourism, as grey reef sharks are suitable for shark-watching ventures, and profitable diving sites now enjoy protection in many countries, such as the Maldives.[6]

References [edit]

  1. ^ a b "Carcharhinus amblyrhynchos". IUCN Red List of Threatened Species. Version 2007. International Union for Conservation of Nature. 2005. Retrieved January 19, 2010. 
  2. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2009). "Carcharhinus amblyrhynchos" in FishBase. April 2009 version.
  3. ^ a b c d e f Martin, R.A. (Mar. 2007). "A review of shark agonistic displays: comparison of display features and implications for shark-human interactions". Marine and Freshwater Behaviour and Physiology 40 (1): 3–34. doi:10.1080/10236240601154872. 
  4. ^ a b c d e f g h i j k Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 459–461. ISBN 92-5-101384-5. 
  5. ^ a b Randall, J.E. and Hoover, J.P. (1995). Coastal fishes of Oman. University of Hawaii Press. p. 29. ISBN 0-8248-1808-3. 
  6. ^ a b Fowler, S.L., Cavanagh, R.D., Camhi, M., Burgess, G.H., Cailliet, G.M., Fordham, S.V., Simpfendorfer, C.A. and Musick, J.A. (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. International Union for Conservation of Nature and Natural Resources. pp. 106–109, 284–285. ISBN 2-8317-0700-5. 
  7. ^ Garrick, J.A.F. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS Circ. 445.
  8. ^ Lavery, S. (1992). "Electrophoretic analysis of phylogenetic relationships among Australian carcharhinid sharks". Australian Journal of Marine and Freshwater Research 43 (1): 97–108. doi:10.1071/MF9920097. 
  9. ^ a b c d Bester, C. Biological Profiles: Grey Reef Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on April 29, 2009.
  10. ^ a b Economakis, A.E. and Lobel, P.S. (1998). "Aggregation behavior of the grey reef shark, Carcharhinus amblyrhynchos, at Johnston Atoll, Central Pacific Ocean". Environmental Biology of Fishes 51: 129–139. doi:10.1023/A:1007416813214. 
  11. ^ a b c Papastamatiou, Y.P., Wetherbee, B.M., Lowe, C.G. and Crow, G.L. (2006). "Distribution and diet of four species of carcharhinid shark in the Hawaiian Islands: evidence for resource partitioning and competitive exclusion". Marine Ecology Progress Series 320: 239–251. doi:10.3354/meps320239. 
  12. ^ a b c d Stafford-Deitsch, J. (1999). Red Sea Sharks. Trident Press. pp. 19–24, 27–32, 74–75. ISBN 1-900724-28-6. 
  13. ^ a b c Bright, M. (2000). The Private Life of Sharks: The Truth Behind the Myth. Stackpole Books. pp. 74–76. ISBN 0-8117-2875-7. 
  14. ^ Whitty, J. (2007). The Fragile Edge: Diving and Other Adventures in the South Pacific. Houghton Mifflin Harcourt. p. 9. ISBN 0-618-19716-8. 
  15. ^ Justine, J. (Jul. 2005). "Huffmanela lata n. sp. (Nematoda: Trichosomoididae: Huffmanelinae) from the shark Carcharhinus amblyrhynchos (Elasmobranchii: Carcharhinidae) off New Caledonia". Systematic Parasitology 61 (3): 181–184. doi:10.1007/s11230-005-3160-8. PMID 16025207. 
  16. ^ Newbound, D.R. and Knott, B (1999). "Parasitic copepods from pelagic sharks in Western Australia". Bulletin of Marine Science 65 (3): 715–724. 
  17. ^ Coetzee, M.L., Smit, N.J., Grutter, A.S. and Davies, A.J. (Feb. 2009). "Gnathia trimaculata n. sp. (Crustacea: Isopoda: Gnathiidae), an ectoparasite found parasitising requiem sharks from off Lizard Island, Great Barrier Reef, Australia". Systematic Parasitology 72 (2): 97–112. doi:10.1007/s11230-008-9158-2. PMID 19115084. 
  18. ^ Coetzee, M.L., Smit, N.J., Grutter, A.S. and Davies, A.J. (2008). "A New Gnathiid (Crustacea: Isopoda) Parasitizing Two Species of Requiem Sharks from Lizard Island, Great Barrier Reef, Australia". Journal of Parasitology 94 (3): 608–615. 
  19. ^ a b Wetherbee, B.M., Crow, C.G. and Lowe, C.G. (1997). "Distribution, reproduction, and diet of the gray reef shark Carcharhinus amblyrhychos in Hawaii". Marine Ecology Progress Series 151: 181–189. doi:10.3354/meps151181. 
  20. ^ Halstead, B.W., Auerbach, Paul S. and Campbell, D.R. (1990). A Color Atlas of Dangerous Marine Animals. CRC Press. p. 11. ISBN 0-8493-7139-2. 
  21. ^ Robbins, W.D. (2006). Abundance, demography and population structure of the grey reef shark (Carcharhinus amblyrhynchos) and the white tip reef shark (Triaenodon obesus) (Fam. Charcharhinidae). PhD thesis, James Cook University.
  22. ^ a b c Martin, R.A. Coral Reefs: Grey Reef Shark. ReefQuest Centre for Shark Research. Retrieved on April 30, 2009.
  23. ^ a b McKibben J.N. and Nelson, D.R. (1986). "Pattern of movement and grouping of gray reef sharks, Carcharhinus amblyrhyncos, at Enewetak, Marshall Islands". Bulletin of Marine Science 38: 89–110. 
  24. ^ a b Nelson, D.R. (1981). "Aggression in sharks: is the grey reef shark different?". Oceanus 24: 45–56. 
  25. ^ a b Taylor, L.R. (1993). Sharks of Hawaii: Their Biology and Cultural Significance. University of Hawaii Press. pp. 21–24. ISBN 0-8248-1562-9. 
  26. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on May 1, 2009.
  27. ^ Anderson, R.C., Sheppard, C., Spalding, M. and Crosby, R. (1998). "Shortage of sharks at Chagos". Shark News 10: 1–3. 
  28. ^ Robbins, W.D., Hisano, M., Connolly, S.R., and Choat, J.H. (2006). "Ongoing collapse of coral reef shark populations". Current Biology 16 (23): 2314–2319. doi:10.1016/j.cub.2006.09.044. PMID 17141612. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!