Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles (Ref. 6727). Feeds on polychaetes, pelecypods, amphipods and other benthic prey (Ref. 6727).
  • Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

off Emerald Bank to South America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal. Eastern Atlantic: Madeira to Western Sahara, off South Africa. Western Atlantic: Gulf of Mexico and South America. Indo-Pacific: Zanzibar and Maldives; near Japan (Ref. 26165). Probably Somalia (Ref. 30573). Eastern Central Pacific (Ref. 9305).
  • Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical and temperate seas, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 1012
  • Sulak, K.J. 1986 Halosauridae. p. 196-197. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3974)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 550 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

55.0 cm TL (male/unsexed; (Ref. 4448))
  • Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body white to grey-brown in color, underside darker (Ref. 3974). Insertion of the pelvic fin only slightly anterior to the origin of the dorsal fin. Lacks scale on the opercle (Ref. 37108).
  • Sulak, K.J. 1986 Halosauridae. p. 196-197. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3974)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Aldrovandia affinis
Catalog Number: USNM 51614
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: Kaiwi Channel, Between Molokai and Oahu Islands: Lae-O Ka Laau Light, Molokai Island, S. 15 Deg. 30', E. 19.4', Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 841 to 860
Vessel: Albatross
  • Type: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 612, pl. 76.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 35551
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 1761 to 1761
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 35418
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 1267 to 1267
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 35638
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, Delaware, United States, Atlantic
Depth (m): 1765
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 33379
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1883
Locality: Nantucket To Cape Sable, N.S., Massachusetts, United States, Atlantic
Depth (m): 1569 to 1569
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 38140
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1886
Locality: Nantucket To Cape Charles, Virginia, United States, Atlantic
Depth (m): 1242 to 1242
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; marine; depth range 730 - 2560 m (Ref. 3974)
  • Sulak, K.J. 1986 Halosauridae. p. 196-197. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3974)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 71 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 397.5 - 2580
  Temperature range (°C): 2.273 - 13.007
  Nitrate (umol/L): 14.608 - 36.774
  Salinity (PPS): 34.361 - 35.960
  Oxygen (ml/l): 2.448 - 6.292
  Phosphate (umol/l): 1.039 - 2.876
  Silicate (umol/l): 8.634 - 121.824

Graphical representation

Depth range (m): 397.5 - 2580

Temperature range (°C): 2.273 - 13.007

Nitrate (umol/L): 14.608 - 36.774

Salinity (PPS): 34.361 - 35.960

Oxygen (ml/l): 2.448 - 6.292

Phosphate (umol/l): 1.039 - 2.876

Silicate (umol/l): 8.634 - 121.824
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 730 - 2560m.
From 730 to 2560 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles. Feeds on polychaetes, pelecypods, amphipods and other benthic prey.
  • Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on polychaetes, pelecypods, amphipods and other benthic prey
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aldrovandia affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACTCGCTGATTCTTTTCTACTAATCACAAAGATATTGGCACCCTTTATTTAGTATTCGGTGCCTGAGCAGGGATGGTGGGGACAGCCCTAAGCCTTTTAATTCGGGCAGAACTAAGCCAACCCGGAGCCCTTTTAGGAGATGACCAAATTTATAATGTTATCGTTACAGCACACGCTTTCGTAATGATCTTCTTTATGGTTATACCCGTAATAATTGGAGGCTTCGGAAACTGACTCGTTCCCCTAATGATCGGCGCCCCCGACATAGCATTCCCGCGAATAAACAACATAAGCTTCTGACTCCTACCCCCGTCATTTCTCCTTCTACTCTCTTCCTCTGGGGTTGAGGCAGGGGCAGGAACAGGCTGAACAGTATACCCCCCACTTGCTAGCAACCTAGCACATGCCGGGGCATCCGTCGACCTAACCATCTTCTCCCTACACCTTGCAGGTATCTCATCAATTCTTGGGGCTATTAACTTCATTACCACAATCATTAACATGAAACCCCCAGCAATCTCACAATATCAAACACCCCTATTTGTATGATCAGTACTTGTCACTGCAGTCTTGCTACTCCTATCTCTACCAGTCCTAGCCGCAGGCATTACCATGCTACTTACGGATCGAAATCTTAATACAACATTCTTTGACCCGGCAGGAGGGGGAGACCCAATTCTGTACCAACATCTGTTCTGATTCTTCGGCCACCCCGAGGTGTATATCCTAATCCTCCCTGGGTTCGGAATAATCTCGCACATCGTCGCATATTATGCCGGCAAAAAAGAACCGTTTGGCTACATAGGAATAGTGTGAGCTATAATGGCCATCGGCCTTCTAGGGTTCATTGTCTGAGCACACCACATATTTACAGTAGGCATAGATGTAGACACACGAGCCTATTTTACATCCGCCACAATAATTATCGCCATCCCCACTGGAGTCAAAGTATTCAGCTGACTAGCCACACTGCATGGGGGCTCTATTAAATGAGACACACCCCTTCTCTGAGCCCTAGGGTTCATCTTCCTCTTTACTGTTGGGGGCTTAACAGGAATTGTACTAGCCAACTCCTCCCTAGATATTGTCCTACACGATACATACTATGTCGTCGCACATTTCCACTACGTCCTCTCTATAGGAGCTGTATTTGCCATCATAGGAGCCTTTGTTCACTGATTCCCGCTATTTACAGGCTACACCCTTCACAGTACTTGAACTAAAATCCACTTCGGAGTAATGTTTTTAGGAGTAAACCTAACTTTCTTCCCCCAACATTTTCTAGGACTGGCAGGAATGCCACGACGATACTCAGATTACCCAGACGCATATACCCTATGAAACACAGTCTCATCCATCGGATCCCTAATCTCCCTCATGGCAGTAATTATGTTCTTATTCATTTTATGAGAAGCATTCGCCGCCAAACGAGAAGTCCTATCCGTAGAACTTACAGCTATAAATGTAGAGTGACTTCATGGTTGTCCTCCCCCATACCACACATTCGAGGAACCAGCCTTCGTTCAAGTTCAATCAGCTTTCGAGAAAGGAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aldrovandia affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!