Overview

Comprehensive Description

Biology

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles (Ref. 6727). Feeds on polychaetes, pelecypods, amphipods and other benthic prey (Ref. 6727).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal. Eastern Atlantic: Madeira to Western Sahara, off South Africa. Western Atlantic: Gulf of Mexico and South America. Indo-Pacific: Zanzibar and Maldives; near Japan (Ref. 26165). Probably Somalia (Ref. 30573). Eastern Central Pacific (Ref. 9305).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

off Emerald Bank to South America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Azores Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, New Zealand Exclusive Economic Zone, North West Atlantic, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and temperate seas, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 1012
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 550 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

55.0 cm TL (male/unsexed; (Ref. 4448))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body white to grey-brown in color, underside darker (Ref. 3974). Insertion of the pelvic fin only slightly anterior to the origin of the dorsal fin. Lacks scale on the opercle (Ref. 37108).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Aldrovandia affinis
Catalog Number: USNM 51614
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: Kaiwi Channel, Between Molokai and Oahu Islands: Lae-O Ka Laau Light, Molokai Island, S. 15 Deg. 30', E. 19.4', Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 841 to 860
Vessel: Albatross
  • Type: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 612, pl. 76.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 35551
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 1761 to 1761
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 35418
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 1267 to 1267
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 35638
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, Delaware, United States, Atlantic
Depth (m): 1765
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 33379
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1883
Locality: Nantucket To Cape Sable, N.S., Massachusetts, United States, Atlantic
Depth (m): 1569 to 1569
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Aldrovandia affinis
Catalog Number: USNM 38140
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1886
Locality: Nantucket To Cape Charles, Virginia, United States, Atlantic
Depth (m): 1242 to 1242
Vessel: Albatross
  • Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine; depth range 730 - 2560 m (Ref. 3974)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 71 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 397.5 - 2580
  Temperature range (°C): 2.273 - 13.007
  Nitrate (umol/L): 14.608 - 36.774
  Salinity (PPS): 34.361 - 35.960
  Oxygen (ml/l): 2.448 - 6.292
  Phosphate (umol/l): 1.039 - 2.876
  Silicate (umol/l): 8.634 - 121.824

Graphical representation

Depth range (m): 397.5 - 2580

Temperature range (°C): 2.273 - 13.007

Nitrate (umol/L): 14.608 - 36.774

Salinity (PPS): 34.361 - 35.960

Oxygen (ml/l): 2.448 - 6.292

Phosphate (umol/l): 1.039 - 2.876

Silicate (umol/l): 8.634 - 121.824
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 730 - 2560m.
From 730 to 2560 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles. Feeds on polychaetes, pelecypods, amphipods and other benthic prey.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aldrovandia affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACTCGCTGATTCTTTTCTACTAATCACAAAGATATTGGCACCCTTTATTTAGTATTCGGTGCCTGAGCAGGGATGGTGGGGACAGCCCTAAGCCTTTTAATTCGGGCAGAACTAAGCCAACCCGGAGCCCTTTTAGGAGATGACCAAATTTATAATGTTATCGTTACAGCACACGCTTTCGTAATGATCTTCTTTATGGTTATACCCGTAATAATTGGAGGCTTCGGAAACTGACTCGTTCCCCTAATGATCGGCGCCCCCGACATAGCATTCCCGCGAATAAACAACATAAGCTTCTGACTCCTACCCCCGTCATTTCTCCTTCTACTCTCTTCCTCTGGGGTTGAGGCAGGGGCAGGAACAGGCTGAACAGTATACCCCCCACTTGCTAGCAACCTAGCACATGCCGGGGCATCCGTCGACCTAACCATCTTCTCCCTACACCTTGCAGGTATCTCATCAATTCTTGGGGCTATTAACTTCATTACCACAATCATTAACATGAAACCCCCAGCAATCTCACAATATCAAACACCCCTATTTGTATGATCAGTACTTGTCACTGCAGTCTTGCTACTCCTATCTCTACCAGTCCTAGCCGCAGGCATTACCATGCTACTTACGGATCGAAATCTTAATACAACATTCTTTGACCCGGCAGGAGGGGGAGACCCAATTCTGTACCAACATCTGTTCTGATTCTTCGGCCACCCCGAGGTGTATATCCTAATCCTCCCTGGGTTCGGAATAATCTCGCACATCGTCGCATATTATGCCGGCAAAAAAGAACCGTTTGGCTACATAGGAATAGTGTGAGCTATAATGGCCATCGGCCTTCTAGGGTTCATTGTCTGAGCACACCACATATTTACAGTAGGCATAGATGTAGACACACGAGCCTATTTTACATCCGCCACAATAATTATCGCCATCCCCACTGGAGTCAAAGTATTCAGCTGACTAGCCACACTGCATGGGGGCTCTATTAAATGAGACACACCCCTTCTCTGAGCCCTAGGGTTCATCTTCCTCTTTACTGTTGGGGGCTTAACAGGAATTGTACTAGCCAACTCCTCCCTAGATATTGTCCTACACGATACATACTATGTCGTCGCACATTTCCACTACGTCCTCTCTATAGGAGCTGTATTTGCCATCATAGGAGCCTTTGTTCACTGATTCCCGCTATTTACAGGCTACACCCTTCACAGTACTTGAACTAAAATCCACTTCGGAGTAATGTTTTTAGGAGTAAACCTAACTTTCTTCCCCCAACATTTTCTAGGACTGGCAGGAATGCCACGACGATACTCAGATTACCCAGACGCATATACCCTATGAAACACAGTCTCATCCATCGGATCCCTAATCTCCCTCATGGCAGTAATTATGTTCTTATTCATTTTATGAGAAGCATTCGCCGCCAAACGAGAAGTCCTATCCGTAGAACTTACAGCTATAAATGTAGAGTGACTTCATGGTTGTCCTCCCCCATACCACACATTCGAGGAACCAGCCTTCGTTCAAGTTCAATCAGCTTTCGAGAAAGGAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aldrovandia affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!