Aldrovandia affinis — Details

Gilbert's Halosaurid learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles (Ref. 6727). Feeds on polychaetes, pelecypods, amphipods and other benthic prey (Ref. 6727).

Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448) http://www.fishbase.org/references/FBRefSummary.php?id=4448&speccode=7502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Circumglobal. Eastern Atlantic: Madeira to Western Sahara, off South Africa. Western Atlantic: Gulf of Mexico and South America. Indo-Pacific: Zanzibar and Maldives; near Japan (Ref. 26165). Probably Somalia (Ref. 30573). Eastern Central Pacific (Ref. 9305).

Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448) http://www.fishbase.org/references/FBRefSummary.php?id=4448&speccode=7502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

off Emerald Bank to South America

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Azores Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, New Zealand Exclusive Economic Zone, North West Atlantic, South Africa (country), Tanzania

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas. http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
van der Land, J.; Costello, M.J.; Zavodnik, D.; Santos, R.S.; Porteiro, F.M.; Bailly, N.; Eschmeyer, W.N.; Froese, R. (2001). Pisces, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 357-374 http://www.marbef.org/data/aphia.php?p=sourcedetails&id=1411
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp. http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Circumglobal in tropical and temperate seas, including Hawaiian Islands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 1; Dorsal soft rays (total): 1012

Sulak, K.J. 1986 Halosauridae. p. 196-197. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3974) http://www.fishbase.org/references/FBRefSummary.php?id=3974&speccode=7502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 550 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

55.0 cm TL (male/unsexed; (Ref. 4448))

Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448) http://www.fishbase.org/references/FBRefSummary.php?id=4448&speccode=7502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Body white to grey-brown in color, underside darker (Ref. 3974). Insertion of the pelvic fin only slightly anterior to the origin of the dorsal fin. Lacks scale on the opercle (Ref. 37108).

Sulak, K.J. 1986 Halosauridae. p. 196-197. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3974) http://www.fishbase.org/references/FBRefSummary.php?id=3974&speccode=7502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Type for Aldrovandia affinis
Catalog Number: USNM 51614
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: Kaiwi Channel, Between Molokai and Oahu Islands: Lae-O Ka Laau Light, Molokai Island, S. 15 Deg. 30', E. 19.4', Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 841 to 860
Vessel: Albatross

Type: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 612, pl. 76.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Aldrovandia affinis
Catalog Number: USNM 35551
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 1761 to 1761
Vessel: Albatross

Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Aldrovandia affinis
Catalog Number: USNM 35418
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 1267 to 1267
Vessel: Albatross

Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Aldrovandia affinis
Catalog Number: USNM 35638
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, Delaware, United States, Atlantic
Depth (m): 1765
Vessel: Albatross

Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Aldrovandia affinis
Catalog Number: USNM 33379
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1883
Locality: Nantucket To Cape Sable, N.S., Massachusetts, United States, Atlantic
Depth (m): 1569 to 1569
Vessel: Albatross

Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Aldrovandia affinis
Catalog Number: USNM 38140
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1886
Locality: Nantucket To Cape Charles, Virginia, United States, Atlantic
Depth (m): 1242 to 1242
Vessel: Albatross

Paratype: Goode, G. B. & Bean, T. H. 1896. Special Bulletin of the United States National Museum. No. 2: 135, fig. 158.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

benthopelagic; marine; depth range 730 - 2560 m (Ref. 3974)

Sulak, K.J. 1986 Halosauridae. p. 196-197. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3974) http://www.fishbase.org/references/FBRefSummary.php?id=3974&speccode=7502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

benthic

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles.

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Known from seamounts and knolls

Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication. http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 71 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 397.5 - 2580
  Temperature range (°C): 2.273 - 13.007
  Nitrate (umol/L): 14.608 - 36.774
  Salinity (PPS): 34.361 - 35.960
  Oxygen (ml/l): 2.448 - 6.292
  Phosphate (umol/l): 1.039 - 2.876
  Silicate (umol/l): 8.634 - 121.824

Graphical representation

Depth range (m): 397.5 - 2580

Temperature range (°C): 2.273 - 13.007

Nitrate (umol/L): 14.608 - 36.774

Salinity (PPS): 34.361 - 35.960

Oxygen (ml/l): 2.448 - 6.292

Phosphate (umol/l): 1.039 - 2.876

Silicate (umol/l): 8.634 - 121.824

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 730 - 2560m.
From 730 to 2560 meters.

Habitat: bathypelagic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Occurs on the middle and lower slope primarily above the 4°C isotherm. Hovers within a few meters of substrate, parallel to it or inclined at varying angles. Feeds on polychaetes, pelecypods, amphipods and other benthic prey.

Sulak, K.J. 1990 Halosauridae. p. 126-132. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4448) http://www.fishbase.org/references/FBRefSummary.php?id=4448&speccode=7502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aldrovandia affinis

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACTCGCTGATTCTTTTCTACTAATCACAAAGATATTGGCACCCTTTATTTAGTATTCGGTGCCTGAGCAGGGATGGTGGGGACAGCCCTAAGCCTTTTAATTCGGGCAGAACTAAGCCAACCCGGAGCCCTTTTAGGAGATGACCAAATTTATAATGTTATCGTTACAGCACACGCTTTCGTAATGATCTTCTTTATGGTTATACCCGTAATAATTGGAGGCTTCGGAAACTGACTCGTTCCCCTAATGATCGGCGCCCCCGACATAGCATTCCCGCGAATAAACAACATAAGCTTCTGACTCCTACCCCCGTCATTTCTCCTTCTACTCTCTTCCTCTGGGGTTGAGGCAGGGGCAGGAACAGGCTGAACAGTATACCCCCCACTTGCTAGCAACCTAGCACATGCCGGGGCATCCGTCGACCTAACCATCTTCTCCCTACACCTTGCAGGTATCTCATCAATTCTTGGGGCTATTAACTTCATTACCACAATCATTAACATGAAACCCCCAGCAATCTCACAATATCAAACACCCCTATTTGTATGATCAGTACTTGTCACTGCAGTCTTGCTACTCCTATCTCTACCAGTCCTAGCCGCAGGCATTACCATGCTACTTACGGATCGAAATCTTAATACAACATTCTTTGACCCGGCAGGAGGGGGAGACCCAATTCTGTACCAACATCTGTTCTGATTCTTCGGCCACCCCGAGGTGTATATCCTAATCCTCCCTGGGTTCGGAATAATCTCGCACATCGTCGCATATTATGCCGGCAAAAAAGAACCGTTTGGCTACATAGGAATAGTGTGAGCTATAATGGCCATCGGCCTTCTAGGGTTCATTGTCTGAGCACACCACATATTTACAGTAGGCATAGATGTAGACACACGAGCCTATTTTACATCCGCCACAATAATTATCGCCATCCCCACTGGAGTCAAAGTATTCAGCTGACTAGCCACACTGCATGGGGGCTCTATTAAATGAGACACACCCCTTCTCTGAGCCCTAGGGTTCATCTTCCTCTTTACTGTTGGGGGCTTAACAGGAATTGTACTAGCCAACTCCTCCCTAGATATTGTCCTACACGATACATACTATGTCGTCGCACATTTCCACTACGTCCTCTCTATAGGAGCTGTATTTGCCATCATAGGAGCCTTTGTTCACTGATTCCCGCTATTTACAGGCTACACCCTTCACAGTACTTGAACTAAAATCCACTTCGGAGTAATGTTTTTAGGAGTAAACCTAACTTTCTTCCCCCAACATTTTCTAGGACTGGCAGGAATGCCACGACGATACTCAGATTACCCAGACGCATATACCCTATGAAACACAGTCTCATCCATCGGATCCCTAATCTCCCTCATGGCAGTAATTATGTTCTTATTCATTTTATGAGAAGCATTCGCCGCCAAACGAGAAGTCCTATCCGTAGAACTTACAGCTATAAATGTAGAGTGACTTCATGGTTGTCCTCCCCCATACCACACATTCGAGGAACCAGCCTTCGTTCAAGTTCAATCAGCTTTCGAGAAAGGAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Aldrovandia affinis

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 13
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!