Overview

Comprehensive Description

Biology

The adults usually live near to the sea floor, but sometimes they also appear near the surface (Ref. 1371). They perform diurnal vertical migrations (Ref. 1371). They mainly feed on krill (Ref. 39882) but they also eat fishes and crustaceans (Ref. 6885). The adults which are spawning are often solely captured for their roe. The meat is used to produce Surimi (this is an imitation of shellfish meat) (Ref. 28499). They are traded as fresh fish, boneless flesh, in frozen blocks or as Surimi. The fish is cooked in the microwave, steamed or fried in butter (Ref. 9988). The Bering Sea/Aleutian Islands (BS/AI), http://www.msc.org/html/content_1176.htm, and Gulf of Alaska (GOA), http://www.msc.org/html/content_492.htm, pollock fisheries of this species have been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific and adjacent Arctic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: from Kivalina, Alaska, to the southern Sea of Japan and to Carmel, California, USA. The occurrence off the northern part of Baja California (Mexico), as reported from Quast and Hall, (1972) (Ref. 6876) is apparently erroneous.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Theragra chalcogramma (Alaska pollock) occupies a wide geographic range and is found in a polar climate across the northern Pacific Ocean, from 68° north to 34° north, and from 129° east to 120° west (Kooka 1998). Alaska pollock inhabit a broad niche spanning the North Pacific, from the eastern Paleartic region to the western Neartic. North American populations lie along the west coast from northern California to northwest Alaska with major populations located southeast of Alaska and Canada and in the western-central Gulf of Alaska. Alaska pollock populations span the coastline of West Asia to South-West Asia and South Asia with the largest populations concentrated in the northwestern Bering Sea, the western Bering Sea, eastern Kamchatka, and the northern Sea of Okhotsk.

Biogeographic Regions: nearctic ; palearctic ; pacific ocean (Native )

  • Kooka, K. 1998. Vertical distribution and prey of walleye pollock in the northern Japan sea. Fisheries Sciecne, 64 (5): 686-693.
  • Bailey, K., D. Powers, J. Quattro, G. Villa, J. Traynor, G. Walters. 1999. Population Ecology and Structural Dyamics of Walleye Pollock. Pp. 581-590 in T Loughlin, K Ohtani, eds. Dynamics of the Bering Sea. Fairbanks, Alaska: University of Alaska Sea Grant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 38 - 48; Analspines: 0; Analsoft rays: 33 - 42
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Theragra chalcogramma has an olive-green belly. Its dorsal side displays a gradually darkening color scheme from the bottom to the top, eventually fading to a dark brown. This fish exhibits characteristic blotches all over its entire body, which is slender with a large head. The head consists of various lateral pores, large eyes, and a protruding lower jaw which lacks a barbel (Bailey 1999). Theragra chalcogramma can be recognized by its two anal fins, three widely dispersed fins on its back, and outstretched pelvic fins. The fins are all a dark grey to black color. A lateral line runs across the fish to its caudal fin. At three to five years old, the average length of this fish is 30.5 centimeters (Harmann 2005). By the time it reaches ages of eight to twelve years, the average length is about 61 centimeters. The maximum length of T. chalcogramma is 91 centimeters. Weights of this fish range from 600 grams to 800. The maximum weight was recorded at 1400 grams (Cohen 1990).

Range mass: 600 to 800 g.

Range length: 30.5 to 91 cm.

Average length: 61 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 3,850 g (Ref. 56335); max. reported age: 15 years (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The dorsal fins are widely separated. The pelvic fins have a slightly elongated filament. The lateral line is continuous to about the back end of the first dorsal-fin base; it is interrupted at the read of the body. On the head are lateral line pores. Body color is olive green to brown on the back and becomes silvery on the sides and pale ventrally, often with mottled patterns or blotches.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Lectotype; Syntype for Theragra chalcogramma
Catalog Number: USNM 44455
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Hume
Locality: Puget Sound, Washington, United States, Pacific
  • Lectotype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 2537.; Jordan, D. S. & Gilbert, C. H. 1893. Proceedings of the United States National Museum. 16 (939): 315.; Syntype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 2537.; Jordan, D. S. & Gilbert, C. H. 1893. Proceedings of the United States National Museum. 16 (939): 315.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Usually offshore, often near bottom (Eschmeyer and Herald 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 975m.
Recorded at 975 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; non-migratory; brackish; marine; depth range 0 - 1280 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Theragra chalcogramma is a saltwater fish that thrives in seas, oceans, and gulfs. It is broadly distributed with greater populations existing in the outer shelf and slope regions of oceanic waters. These fish, semi-demersal in some regions and pelagic in others (due to feeding on a variety of pelagic and demersal prey), are able to survive in large estuaries, coastal areas, and open basins. Alaska pollock are limited to northern regions reflecting this species' limited temperature tolerance. They can only withstand a range of ten to twelve degrees Celsius (Bailey 1999). Common trends exhibit an age-dependent depth distribution. Fish less than one year old live throughout the water column, one-year-olds live at bottom trawls, two- to three-year-olds live higher in the column, and fish at least four years old display demersal behavior. The thermal range of these fish decreases with age. Younger fish have a greater range of temperature tolerance than older fish, which remain at lower depths where the temperature is a constant one to six degrees Celsius (Avdeev 2001).

Range depth: 1280 (high) m.

Average depth: 366 m.

Habitat Regions: polar ; saltwater or marine

Aquatic Biomes: pelagic ; benthic ; coastal

Other Habitat Features: estuarine

  • Avdeev, G.V, G., E. Avdeev. 2001. Patogenic [pathogenic] influence rendered by parasitic copepod Haemobaphes diceraus on Alaska pollock. Zoological Record Plus, 128(1): 287-292, 336, 342.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3965 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1921 samples.

Environmental ranges
  Depth range (m): 0 - 437
  Temperature range (°C): -1.437 - 8.705
  Nitrate (umol/L): 0.707 - 38.832
  Salinity (PPS): 31.267 - 34.091
  Oxygen (ml/l): 2.565 - 8.635
  Phosphate (umol/l): 0.634 - 2.665
  Silicate (umol/l): 11.160 - 65.864

Graphical representation

Depth range (m): 0 - 437

Temperature range (°C): -1.437 - 8.705

Nitrate (umol/L): 0.707 - 38.832

Salinity (PPS): 31.267 - 34.091

Oxygen (ml/l): 2.565 - 8.635

Phosphate (umol/l): 0.634 - 2.665

Silicate (umol/l): 11.160 - 65.864
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pelagic species which employs different foraging styles under different food distributions (Ref. 30688). Feed mainly on krill. Also feed on zooplankton such as copepod, small shrimp, squid and small fish (Ref. 39882). Cannibalistic (Ref. 43846). Length range, (FL: 10 to 78.1 cm) of walleye pollock consumed by Steller sea lions in Southeast Alaska between 1994 to 1999 (Ref. 53504).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Theragra chalcogramma feeds on both fish and invertebrates (Bailey 1999). The diet of this fish varies by developmental stage, season, and body size. Larvae tend to consume zooplankton such as larval copepods, while older T. chalcogramma tend to eat larger food items such as adult Acartia and Pseudocalanus. In winter, adult pollock feed mostly on fishes and euphausiid krill. In spring, T. chalcogramma feed on Appendicularia. In summer, the diet consists of euphausiids and copepods and in autumn, they feed on mainly euphausiids (Kooka 1998). Large T. chalcogramma have a diet rich in small pollock (specifically in the eastern Bering Sea) and shrimp. In areas where the juvenile population is extremely large, such as in the eastern Bering Sea, cannabalistic adults prey on the juveniles. Smaller-sized individuals are more likely to consume copepods and euphausiids (Avdeev 2001).

Animal Foods: fish; aquatic crustaceans; other marine invertebrates; zooplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

In the Bering Sea, Theragra chalcogramma plays a key role as both predator and prey. The reproductive success of stellar sea lions is dependent on T. chalcogramma (Avdeev 2001).

Predator-prey interactions for T. chalcogramma fluctuate with seasonal conditions. One-year-old pollock occupy different areas depending on temperature. This change in local abundance affects the annual populations of other species in the region.

When infected with the parasitic copepod Haemobaphes diceraus, there is a decrease in the body weight of T. chalcogramma as well as an increase in the weight of its spleen. If T. chalcogramma is infected during the juvenile stage of development, it suffers from delayed maturity, and if it is infected as an adult, it experiences a decrease in reproductive success (Bailey 1999).

Ecosystem Impact: keystone species

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Theragra chalcogramma larvae are preyed on by northern rockfish, polka-dot snailfish, and atka mackeral. One-year-olds are preyed on by greenland turbot, plain sculpin, and arrowtooth flounder. Those that are two years old are hunted by greenland turbot, bigmouth sculpin, sablefish, pacific cod, plain sculpin, pacific halibut, and great sculpin. Adult T. chalcogramma fall prey to yellow irish lords and plain sculpin (Cohen 1990; Kooka 1998). In the Gulf of Alaska, T. chalcogramma is the primary prey of stellar sea lions (Cohen 1999).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Limited information pertaining to the communication and perception of Theragra chalcogramma exists. Most schooling fish, however, use visual cues for schooling and feeding (Bailey 1999).

Communication Channels: visual

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Congregate in dense schools to spawn, usually at 50 to 250 m depth.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Newly fertilized pelagic eggs of Theragra chalcogramma are approximately 3.4 mm in diameter. The eggs hatch in approximately 28 days at a temperature of three degrees Celcius. The length of each larva when it settles out is 3.8 to 5.1 centimeters (Love 1996). The larval developmental stage is considered complete within approximately 50 days. Females grow at the same rate as, or slightly faster than, males. Immature fish swim towards the surface at night to capture prey. The pre-spawning stage begins at age 2 years. Female T. chalcogramma reach maturity at three to four years at an average length of 36 centimeters, while males mature at ages four to five years (Bailey 1999).

  • Love, M. 1996. Probably more than you want to know about the fishes of the Pacific coast.. Sante Fe, California: Really Big Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The mortality coefficient for Theragra chalcogramma is 0.3 on the eastern Bering Sea shelf (0.3 implying that that the annual natural morality rate is 30%) and 0.2 on the Aleutian Basin. Theragra chalcogramma usually lives from 12 to 16 years. The oldest T. chalcogramma ever reported was 31 years old (Bailey 1999).

Range lifespan

Status: wild:
31 (high) years.

Typical lifespan

Status: wild:
12 to 16 years.

Average lifespan

Status: captivity:
17 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

These fish spawn in large groups. The mating system of Theragra chalcogramma consists of females releasing their eggs and then males randomly fertilizing them (Love 1996). Females are referred to as batch spawners that release eggs every few days for one month per year.

Mating System: polygynandrous (promiscuous)

Spawning of Theragra chalcogramma occurs in water depths of 90 to 200 meters. Spawning, which occurs for an entire month, is annual and the peak spawning season fluctuates from region to region. Early spawning, in the months of February, March and April, occurs in the Bering Sea. Later spawning, in the months of April, May, and June, occurs further inward over the continental slope and shelf. Spawning fish (three- to four-year-old females and four- to five-year-old males) and pre-spawning fish (two-year-old females) swim high to mid-water in dense schools. The amount of eggs that each female holds is proportional to her body size. Females of approximately 60 centimeters produce 500,000 to 600,000 eggs while females with lengths of 40 to 45 centimeters produce about one third of that. The largest of females have been known to produce up to one million eggs (Harmann 2005). Theragra chalcogramma eggs, which are transported by currents, are planktonic (Love 1996). The eggs take anywhere from 9 to 28 days to hatch.

Breeding interval: Theragra chalcogramma spawn once yearly

Breeding season: March to August in eastern Bering Sea and January to March in Aleutian Basin

Range number of offspring: 100,000 to 1,000,000.

Range time to hatching: 9 to 28 days.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Besides the energy put into gamete production and spawning, Theragra chalcogramma makes no investment in its offspring.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Gadus chalcogrammus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 129
Specimens with Barcodes: 151
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Gadus chalcogrammus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 143 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATTCGAGCAGAGCTCAGTCAACCTGGTGCACTTCTTGGTGATGATCAAATTTATAATGTGATCGTTACAGCGCACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTTGGAAACTGACTCATTCCTCTAATGATCGGTGCCCCAGATATAGCTTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTTCCCCCATCTTTCCTGCTCCTTTTAGCATCCTCTGGTGTAGAAGCTGGGGCTGGAACAGGCTGAACTGTCTATCCACCTTTAGCCGGAAACCTCGCTCATGCTGGGGCATCTGTTGATCTCACTATTTTCTCTCTTCATCTAGCAGGGATTTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAATATGAAACCTCCAGCAATTTCACAGTACCAAACACCCCTATTTGTTTGAGCAGTACTAATTACAGCCGTGCTTCTACTTCTATCTCTCCCCGTCTTAGCAGCTGGTATCACAATACTTCTAACTGACCGTAATCTTAATACTTCTTTCTTCGATCCTGCTGGAGGGGGTGACCCCATTTTATATCAACACTTATTCTGATTCTTCGGCCACCCCGAAGTTTATATTCTTATTTTACCCGGATTCGGAATAATTTCCCATATCGTAGCATACTATTCAGGTAAAAAAGAACCCTTCGGGTACATGGGTATAGTCTGAGCTATGATGGCTATTGGCCTCCTCGGCTTTATTGTATGAGCCCATCACATGTTTACAGTTGGGATGGACGTAGACACACGTGCTTACTTTACATCTGCAACTATAATTATTGCCATTCCAACAGGTGTAAAAGTCTTTAGCTGATTAGCAACTCTGCATGGAGGCTCAATTAAATGAGAAACCCCCCTACTCTGAGCCCTAGGTTTCATTTTCCTCTTTACAGTTGGGGGCTTAACAGGAATTGTACTAGCCAATTCTTCCCTAGATATTGTGCTCCATGACACATATTACGTAGTAGCCCATTTTCACTACGTTTTATCTATAGGAGCTGTCTTTGCTATTATAGCAGCCTTTGTGCATTGATTCCCTTTATTCACAGGCTATACACTTCATGATACTTGAACAAAAATTCATTTCGGAGTAATATTTGTGGGTGTAAATCTTACATTCTTCCCCCAGCATTTCCTAGGTCTTGCAGGAATACCACGACGGTACTCAGACTACCCTGATGCCTATACACTATGAAATACAGTCTCTTCTATCGGCTCTCTAATTTCCCTTATGGCCGTAATCATATTCCTATTTATTCTGTGAGAAGCTTTCGCTGCCAAACGGGAAGTAATAGCAGTTGAAATAACTATAACTAACGTTGAGTGACTCCACGGGTGTCCCCCTCCCTACCACACATTTGAGGAACCCGCATTCGTCCAAATTCAAACCCGCTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is not threatened and is not listed on the 2004 IUCN Red List of Threatened Species nor is it listed as endangered by the U.S. Fish and Wildlife Service. The most important site of reproduction for this species, the Shelikof Strait in the Gulf of Alaska, has an annual period of time in which fishing is prohibited. This enforced fishing restriction was put in place to prevent potential decreases in this species due to this region having such a large T. chalcogramma density during spawning season (Bailey 1999).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no adverse effects of Theragra chalcogramma on humans (Kooka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

This species is a valuable fish for fisheries on the Russian, Japanese, and Korean coasts. The fish is sold frozen, as fillets, fish sticks, surimi, and roe in Japan (Love 1996). The desire for this fish has gone up in recent years; however, it still lacks appreciation on the North Californian coast where its abundance is high. In addition to being used for food, it is also utilized for fish meal and industrial products.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alaska pollock

Alaska pollock or walleye pollock (Theragra chalcogramma) is a species of the cod family Gadidae. Alaska pollock is a semipelagic schooling fish widely distributed in the North Pacific with largest concentrations found in the eastern Bering Sea.[1]

While related to the common Atlantic pollock species of the same family, the Alaska pollock is not a member of the same Pollachius genus. Rather, recent research suggests that it is more closely related to Atlantic cod, and that Alaska pollock should be moved back to genus Gadus in which it was originally described as Gadus chalcogrammus.[2][3] Furthermore, Norwegian pollock (Theragra finnmarchica), a rare fish of Norwegian waters, is likely the same species as the Alaska pollock.[2][4]

Ecology and behaviour[edit]

The speckled colouring of Alaska pollock makes it more difficult for predators to see them when they are near sandy ocean floors.[5] They are a relatively fast growing and short-lived species, currently representing a major biological component of the Bering Sea ecosystem.[1] It has been found that catches of Alaska pollock go up three years after stormy summers. The storms stir up nutrients, and this results in phytoplankton being plentiful for longer, which in turn allows more pollock hatchlings to survive.[6]

Alaska pollock has well-developed drumming muscles[7] that the fish use to produce sounds during courtship[8] like many other gadids.[9]

Fisheries[edit]

Global capture of Alaska pollock in tonnes reported by the FAO, 1950–2010[10]

The Alaska pollock has been said to be "the largest remaining source of palatable fish in the world."[11] Around 3 million tons of Alaska pollock are caught each year in the North Pacific from Alaska to northern Japan. Alaska pollock is world's second most important fish species in terms of total catch.[12]

Alaska pollock catches from U.S. fisheries have been quite consistent at about 1.5 million tons a year, almost all of it from the Bering Sea. Information on the current stock status for Alaska groundfish is updated annually, whereas the specific 2007 pollock assessment is also available. The Alaska pollock landings are the largest of any single fish species in the U.S. However, in each of the last three years, the pollock population has declined; in 2008, it fell 38 percent and it was worried that the 2008 pollock catch will be the lowest in 30 years.[13] Although the fishery has been hailed as an example of good management, and the Marine Stewardship Council declared it "sustainable",[14] Greenpeace has criticized its management for many years and placed pollock on its international "red list" of endangered fish. In response to the new data, Greenpeace called for 2009 catch levels to be reduced to half those of 2008 to avoid further long-term declines.[15]

This decline has led some scientists [according to whom?] to worry that Alaska pollock could be about to repeat the kind of collapse experienced by Atlantic cod, which could have negative consequences for the world food supply and the entire Bering Sea ecosystem. Halibut, salmon, endangered Steller sea lions, fur seals, and humpback whales all eat pollock and rely on healthy populations to sustain themselves.[16]

As food[edit]

Compared with pollock, Alaska pollock has a milder taste, whiter color and lower oil content.

High quality, single frozen whole Alaska pollock fillets may be layered into a block mold and deep frozen to produce fish blocks that are used throughout Europe and North America as the raw material for high quality breaded and battered fish products. Lower quality, double-frozen fillets or minced trim pieces may also be frozen in block forms and used as raw material for lower quality, low-cost breaded and battered fish sticks, portions, etc.

Single frozen Alaska pollock is considered to be the premier raw material for surimi; the most common use of surimi in the United States is "imitation crabmeat" (also known as crab stick).[citation needed] It is the main ingredient in the surimi-based sandwich product called "Seafood Sensation" sold by the Subway fast-food chain.[citation needed]

Alaska pollock is commonly used in the fast food industry, for example the Filet-O-Fish sandwich and Fish McBites at McDonald's.[17] It is also used by Dairy Queen,[18] Arby's,[citation needed] Long John Silvers,[citation needed] Carl's Jr.,[citation needed] Birds Eye[citation needed] and Burger King.[citation needed] Salted or smoked pollock roe is widely used in Japanese and Russian cuisines as well.

References[edit]

  1. ^ a b Walleye Pollock Research Alaska Fisheries Science Center
  2. ^ a b Byrkjedal, I.; D. J. Rees; Jørgen S. Christiansen; Svein-Erik Fevolden (2008-10-01). "The taxonomic status of Theragra finnmarchica Koefoed, 1956 (Teleostei: Gadidae): perspectives from morphological and molecular data". Journal of Fish Biology 73 (5): 1183–1200. doi:10.1111/j.1095-8649.2008.01958.x. 
  3. ^ Carr, Steven M.; H. Dawn Marshall (2008). "Phylogeographic analysis of complete mtDNA genomes from walleye pollock (Gadus chalcogrammus Pallas, 1811) shows an ancient origin of genetic biodiversity". Mitochondrial DNA 19 (6): 490–496. doi:10.1080/19401730802570942. Retrieved 2012-03-24. 
  4. ^ Ursvik, Anita; Ragna Breines, Jørgen S. Christiansen, Svein-Erik Fevolden, Dag H. Coucheron, Steinar D. Johansen (2007-06-07). "A mitogenomic approach to the taxonomy of pollocks: Theragra chalcogramma and T. finnmarchica represent one single species". BMC Evolutionary Biology 7 (1): 86. doi:10.1186/1471-2148-7-86. 
  5. ^ Alaska pollock NOAA FishWatch. Retrieved 5 November 2012.
  6. ^ "How the weather affects life in the deep" by Aria Pearson, New Scientist, Jan. 3, 2009, pp. 32–35.
  7. ^ Hawkins, A. D.; K. J. Rasmussen (1978). "The calls of gadoid fish". Journal of the Marine Biological Association of the United Kingdom 58: 891–911. doi:10.1017/s0025315400056848. 
  8. ^ Park, Yong-Seok; Yasunori Sakurai; Tohru Mukai; Kohji Iida; Noritatsu Sano (2004). "Sound production related to the reproductive behavior of captive walleye pollack Theragra chalcogramma (Pallas)". Nippon Suisan Gakkaishi (in Japanese, with an English abstract) 60: 467–472. 
  9. ^ Skjæraasen, J. E.; Meager, J. J.; Heino, M. (2012). "Secondary sexual characteristics in codfishes (Gadidae) in relation to sound production, habitat use and social behaviour". Marine Biology Research 8 (3): 201. doi:10.1080/17451000.2011.637562.  edit
  10. ^ Theragra chalcogramma (Pallas, 1811) FAO, Species Fact Sheet. Retrieved April 2012.
  11. ^ Clover, Charles. 2004. The End of the Line: How Overfishing is Changing the World and What We Eat. Ebury Press, London. ISBN 0-09-189780-7
  12. ^ FAO (Food and Agriculture Organization of the United Nations) (2010). The State of World Fisheries and Aquaculture 2010. Rome: FAO. ISBN 978-92-5-106675-1. 
  13. ^ Bernton, Hal. "Business & Technology | Seattle trawlers may face new limits on pollock fishery | Seattle Times Newspaper". Seattletimes.nwsource.com. Retrieved 2012-04-25. 
  14. ^ "WWF - Alaskan & Russian Pollock". Wwf.panda.org. Retrieved 2013-09-14. 
  15. ^ Media release - October 9, 2008 (2008-10-09). "World's Largest Food Fishery in Danger of Collapse". Greenpeace. Retrieved 2012-04-25. 
  16. ^ "Rethinking Sustainability - A new paradigm for fisheries management". greenpeace.org. March 2006. Retrieved 2013-09-14. 
  17. ^ McDonald's Myth Busters
  18. ^ "Dairy Queen ingredients". Idq.com. Retrieved 2012-04-25. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!