Overview

Comprehensive Description

Biology

Occurs in fresh, brackish and coastal waters (Ref. 7251). Primarily found in brackish water but common in pools and other quiet water areas of medium to large rivers, usually over mud. Neither anterolateral glandular groove nor venom gland is present (Ref. 57406).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range encompasses Atlantic Slope drainages from St. Lawrence-Lake Ontario drainage, Quebec, south to Peedee River, South Carolina; Lake Ontario populations may have colonized through the Erie Canal; few records from the Lake Erie drainage. Peak abundance of this species is in the Hudson River and Chesapeake Bay (Lee et al. 1980). Inland populations are more common in northern areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lake Ontario drainage in Quebec to Peedee River, Gulf of St. Lawrence to South Carolina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range encompasses Atlantic Slope drainages from St. Lawrence-Lake Ontario drainage, Quebec, south to Peedee River, South Carolina; Lake Ontario populations may have colonized through the Erie Canal; few records from the Lake Erie drainage. Peak abundance of this species is in the Hudson River and Chesapeake Bay (Lee et al. 1980). Inland populations are more common in northern areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

White perch are normally found along the Atlantic coast of North America from New Jersey to South Carolina. They have been introduced into Lake Erie and Lake Ontario, and many smaller lakes.

Biogeographic Regions: nearctic (Introduced , Native )

  • Etnier, D., W. Starnes. 1993. The Fishes of Tennesse. Knoxville: The University of Tennesse Press.
  • Stanley, J., D. Danie. 1983. "White Perch" (On-line). Accessed October 23, 2005 at http://www.nwrc.usgs.gov/wdb/pub/0199.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: St. Lawrence-Lake Ontario drainage in Quebec, Canada south to Peedee River in South Carolina, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Morone americana (white perch) is found along the Atlantic coast area of the Nearctic region, ranging from the coastal areas of New Jersey as far south as South Carolina. The species has been introduced into inland bodies of water in New England and some of Nebraska’s waters as well as Lakes Ontario and Erie.

Biogeographic Regions: nearctic (Introduced , Native )

  • Etnier, D., W. Starnes. 1993. The Fishes of Tennesse. Knoxville: The University of Tennesse Press.
  • Stanley, J., D. Danie. 1983. "White Perch" (On-line). Accessed October 23, 2005 at http://www.nwrc.usgs.gov/wdb/pub/0199.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic Slope drainages, Quebec Canada and eastern and central U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: from St. Lawrence-Lake Ontario drainage in Quebec, Canada south to Peedee River in South Carolina, USA.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

White perch are deep bodied fish with small pointed teeth. They are usually about 7 to 10 inches long, and weigh from 8 ounces to 1 pound. They have a white belly and dark green-grey on their back. During the breeding season, the chin may turn purplish, and the fins may turn red at the base.

Range length: 495 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Average mass: 1210 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Species in the genus Morone are generally deep bodied fishes with complete lateral lines, ctenoid scales, and an opercular spine. Their jaws contain conical, villiform teeth which are set close together. The pelvic fin contains 1 spine and 5 rays, the caudal fin has 17 principal rays, and there are 7 branchiostegal rays, 3 anal spines, and 2 dorsal fins, one with 9 spines and the other with 1 spine and 10-14 soft rays. Morone americana has a silvery green-gray or dark color above with silver or brass sides and a white underside. During spawning the underside of the mandible may be a pink or blue to purplish color. Often the caudal and pelvic fins have a reddish colored base. The body is oblong and dorsoventrally compressed with a depressed head, and a pointed nose with an oblique terminal mouth and a projecting jaw. Teeth are small, pointed, and banded on the jaw. The dorsal fins are hardly connected and about equivalent in length. Morone americana differs from other members of the genus by the dorsal fin connection being so slight, by having no teeth on the base of the tongue and no lateral stripes, by and the anal spines being ungraduated.

Range length: 495 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Average mass: 1210 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 48 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 480 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

49.5 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 2,200 g (Ref. 7251); max. reported age: 16 years (Ref. 72462)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 48.0 cm TL (male/unsexed); max. weight: 2,200.0 g.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species occurs predominately in brackish water and generally close to shore in saltwater. It is common in quiet water, usually over mud, far up medium to large rivers in fresh water and in lakes and ponds having no sea connection. It has been observed to move offshore during day, onshore at night. Spawning occurs in shallow water, fresh or slightly brackish. Eggs sink to bottom and stick (Thomson et al. 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous species, prefer mud bottoms, found to depths of 10 m; landlock populations also exist.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs predominately in brackish water and generally close to shore in saltwater. It is common in quiet water, usually over mud, far up medium to large rivers in fresh water and in lakes and ponds having no sea connection. It has been observed to move offshore during day, onshore at night. Spawning occurs in shallow water, fresh or slightly brackish. Eggs sink to bottom and stick (Thomson et al. 1978).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White perch usually live in estuaries (such as the Chesapeake Bay), where the water is slightly salty. They can also live in fresh water, as in Lake Erie and Lake Ontario.

Average depth: 10 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 10 - ? m (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morone americana inhabits mainly brackish water and estuaries such as the Chesapeake Bay. Members of the same genus (Morone) reside in large bodies of water such as lakes, reservoirs, estuaries, or bays among others.

Average depth: 10 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 18
  Temperature range (°C): 11.047 - 11.047
  Nitrate (umol/L): 2.030 - 2.030
  Salinity (PPS): 32.507 - 32.507
  Oxygen (ml/l): 6.429 - 6.429
  Phosphate (umol/l): 0.528 - 0.528
  Silicate (umol/l): 2.411 - 2.411

Graphical representation

Depth range (m): 0 - 18
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; freshwater; brackish; marine; depth range to 10 m. In fresh and coastal waters but most often found in brackish water. Also in pools or other quiet water areas of medium to large rivers, usually over mud.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Some populations anadromous.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Young eat microplankton; as they grow larger, aquatic insect larvae become important part of diet. Large individuals consume a high percentage of fishes (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Adult white perch mainly eat other fish, but the young eat eggs, insects, worms, crustaceans and small pieces of animal debris.

Animal Foods: fish; eggs; insects; mollusks; aquatic or marine worms; aquatic crustaceans; zooplankton

Other Foods: detritus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in fresh, brackish and coastal waters (Ref. 7251). Primarily found in brackish water but common in pools and other quiet water areas of medium to large rivers, usually over mud. Anadromous species. In freshwater they feed on aquatic insects (caddisflies, mayflies, dragonflies and midge larvae), fish eggs and small fishes (smelt, yellow perch, elvers and the young of their own species); crustaceans, small fishes and fish eggs consumed in the salt water.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

White perch are primarily piscivorous, feeding on other fish such as those in the families Cyprinidae and Osmeridae. Other major components of the diet of M. americana are fish eggs and larvae, annelids, insects, some crustaceans, and detritus.

Larval white perch feed off of zooplankton. As they grow, they tend to eat larger zooplankton and insects in spring, and as these populations wane their diet switches to larval fish, eggs, detritus, and crustaceans, and in some areas shrimp, squid, and crabs. Once white perch grow to 22 cm they eat almost nothing but other fish.

Animal Foods: fish; eggs; insects; mollusks; aquatic or marine worms; aquatic crustaceans; zooplankton

Other Foods: detritus

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In salt or brackish water white perch feed on small fish fry and spawn of all kinds, young squid, shrimps, crabs, and various other invertebrates.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

White perch are important to their ecosystem both as predators and as prey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

White perch are more likely to be eaten when they are young than when they are adults. Adults are eaten by striped bass, walleye, bluefish and weakfish, and eggs and larvae are eaten by bluegill, copepods and other white perch.

White perch produce a large number of young instead of relying on camouflage or predator avoidance behavior. This way, even if many young are eaten, some will still survive to reproduce.

Known Predators:

  • Morone_saxatilis (striped bass)
  • Stizostedion_vitreum (walleye)
  • Pomatomus_saltator (bluefish)
  • Cynoscion_regalis (weakfish)
  • Morone_americana (white perch)
  • Lepomis_macrochirus (bluegill)
  • Cyclops_bicuspidatus (copepod)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

As an important predator on a large number of species and an important prey species of some fish, copepods and terrestrial vertebrates, white perch fill many roles within their environment depending on age, size, competition, and season. They occupy different depths and are opportunistic feeders.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predation usually occurs within the embryonic and larval stages, but is not uncommon in the juvenile stage. It is less common in the adult stage. Of the recognized predators, Morone saxatilis (striped bass), Sander vitreus (walleye), Pomatomus saltatrix (bluefish), and Cynoscion regalis (weakfish) prey mainly on juveniles and adults. Morone americana (white perch), Lepomis macrochirus (bluegill), and Cyclops bicuspidatus (a copepod), are mainly larval and egg predators.

Because of the low degree of predation on adults, white perch do not show strong camouflage or avoidance techniques. The adaptation that appears most important is the large number of eggs produced during spawning.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Morone americana is prey of:
Leiostomus xanthurus
Morone americana
Pomatomus saltatrix

Based on studies in:
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Morone americana preys on:
Bacteria attached to sediment POM
Bacillariophyceae
microzooplankton
zooplankton
Ctenophora
Chrysaora quinquecirrha
Other suspension feeders
Mya arenaria
Crassostrea virginica
Polychaeta
Nereis
Macoma
Actinopterygii
Alosa pseudoharengus
Alosa chrysochloris
Anchoa mitchilli
Brevoortia tyrannus
Alosa sapidissima
Micropogonius undulatus
Trinectes maculatus
Leiostomus xanthurus
Morone americana
Stizostedion vitreum

Based on studies in:
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations) (e.g., see map in Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Juveniles feed on plankton, adults prefer aquatic insects, crustaceans, fish eggs, smelt, yellow perch, elvers, and their own young
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Little is known about how white perch communicate. They are able to see, hear and smell, and they can detect vibrations in the water.

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

There is little information available on communication in M. Americana. It is able to perceive its environment using vision, hearing, chemoreception and detection of vibrations by the lateral line system.

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

White perch eggs take 2 to 5 days to hatch. When they first hatch, the tiny young are called prolarvae. They are only 2 or 3 mm long, and do not have fins yet. They have no mouths yet, so they use stored food energy from their yolk sac. They also cannot see yet.

After about 13 days, the prolarvae have grown to about 4 mm long. Their mouths develop, and their eyes begin to work. They are now called postlarvae.

When the postlarvae are 7 to 9 mm long, their fins develop and they are called juveniles. The juveniles stay in creeks and rivers where the water is murky and there are many plants.

White perch become adults when they are 2 to 4 years old, and males are 72 to 80 mm long and females are 90 to 98 mm long. When there are many fish in an area, they may not grow as large.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Assuming same mode of reproduction as in M. saxatilis.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

White perch development consists of four stages: embryonic, larval, juvenile, and adult. The embryonic stage is short and begins directly after fertilization. The young develop within a mature egg for 30 to 108 hours depending upon water temperature, where warmer water reduces the incubation period.

The larval stage begins at hatching and is divided into two stages: prolarval and postlarval. Upon hatching, prolarvae measure 1.7 to 3.0 mm in length, and stay in the place they were spawned for 4 to 13 days. They lack pigmentation in the eyes and are not very mobile. Later in the prolarval stage, larvae grow to 3 to 4 mm and begin to swim up or down in the water column, resulting in dispersal due to water currents. Older and larger individuals seek deeper waters. Prolarvae move into the postlarval stage when they develop mouths and coloration in the eyes, and average 3.8 mm in length. Postlarvae continue to grow and develop but are sensitive to temperature fluctuations and water salinity up to 3 to 5 ppt.

When larvae produce fins and grow to total lengths of 7 to 9 mm, they are dubbed juveniles. Juveniles stay close to shore and use creeks and rivers as nurseries. They prefer demersal habitats, living in muddy and silty waters containing aquatic plants. They may stay in these areas for up to a year and reach lengths of 20 to 30 mm, but remain reproductively immature until 2 to 4 years of age, when males are 72 to 80 mm long and females 90 to 98 mm.

Growth rate and size are determined by several external limiting factors such as temperature, precipitation, food availability, and competition. The most growth occurs during the first year of life, and it is then that external factors are most influential. White perch grow slowly and are often stunted when population densities are high. It is also a common trend for warmer water with less rainfall to produce faster growing individuals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of white perch. However, closely related species such as river perch, european perch, and largemouth bass live up to 15 to 25 years.

Average lifespan

Status: wild:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Little is known about the lifespan of M. americana. However, closely related species such as river perch, european perch, and largemouth bass live up to 15 to 25 years.

Average lifespan

Status: wild:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns mainly in spring. Eggs hatch in about 4 days at usual spawning temperature (15 C).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

When a female white perch is ready to mate, a group of males surrounds her. She releases her eggs into the water and they stick to the bottom. All the males release their sperm at the same time, so the eggs can be fertilized by different fathers.

Mating System: polyandrous

White perch breed once a year between March and July. They can breed in many kinds of habitat, but they always choose water that is less than 7 m deep. Some white perch breed in the same place they live, but many travel long distances to find good breeding habitat, especially if they live in the ocean. They can reproduce in water that is somewhat salty, but they prefer fresh water.

White perch usually lay their eggs in the evening or after it rains. Each female can lay between 20,000 and 200,000 eggs. The eggs stick together in a clump and may also stick to the bottom. The parents then leave and do not take care of the eggs.

Breeding interval: White perch spawn one time per year.

Breeding season: White perch spawn between March and July.

Range time to hatching: 30 to 108 hours.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Adult white perch do not take care of their eggs or larvae.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morone americana is polyandrous, without mate guarding or displays of dominance. A ripe female is merely enveloped by a group of males. The sperm and eggs are released at random into the environment, where the eggs stick to one another and to the substrate, and sperm from various males fertilize them.

Mating System: polyandrous

White Perch are anadromous fish which spawn once yearly. They prefer freshwater bodies but are fairly diverse in spawning habitat. They can reproduce in water with salinity levels as high as 4.2 ppt, in tidal or non tidal, clear or murky, slow moving or fast waters. The lack of a need for specialized breeding habitat allows them to reproduce in almost any water system, from lakes and ponds to estuaries or rivers. Spawning always occurs in water less than 7.01 m deep. Individuals tend to spawn in estuarine waters 0.91 m to 6.10 m deep, lake waters up to 1.52 m deep, and in marshes up to 3.66 m deep.

Diversity of breeding habitat allows many M. americana to spawn in the same waters they normally inhabit. However, some populations travel up to 104.61 Km to spawn, and all marine populations must migrate to waters within the proper salinity constraints. Spawning behavior is triggered by temperature fluctuations in early spring. Populations can be split into four major periods of spawning. The Northern populations spawn from March to early April, while the Southern are later. Estuarine populations spawn from May through July, and freshwater populations from April to May.

During spawning there may be two or three different periods of ripe egg release, generally at dusk or after rain. Fecundity for small females (151 to 160 mm fork length) averages 21,180 eggs per individual, and for larger females (241 to 250 mm fork length) 234,342 eggs. At release, the eggs adhere to the substrate or can stick to each other and be free-floating. After the eggs reach maturity they hatch at different intervals determined by water temperature; at 20˚ C they hatch in 30 hrs, at 18˚C hatch within 50 hrs, and at 15˚ C between 96 and 108 hrs. The hatcheries are not gaurded and larvae are independant upon hatching.

Breeding interval: White perch spawn one time per year.

Breeding season: White perch spawn between March and July.

Range time to hatching: 30 to 108 hours.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Adults do not guard eggs and no parental care is provided for the larvae. The largest energy expenditure in reproduction occurs if an individual migrates to spawn.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawning season is April, May, and June in southern New England.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Morone americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Morone americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGCGCTTGAGCTGGTATAGTCGGCACTGCTTTAAGCCTTCTTATTCGAGCAGAGCTGAGCCAACCGGGCGCCCTCCTTGGCGACGATCAGATCTATAATGTGATCGTTACCGCACACGCATTTGTAATAATCTTTTTTATAGTTATACCAATTATGATTGGAGGGTTTGGAAACTGACTAATCCCTTTAATGATTGGGGCGCCAGACATGGCATTCCCCCGAATAAACAACATGAGTTTTTGACTACTTCCTCCATCTTTCCTTCTCCTTCTGGCCTCTTCTGGTGTCGAAGCTGGAGCCGGAACCGGCTGAACCGTCTATCCCCCACTTGCAAGTAACCTTGCACACGCAGGAGCATCCGTAGATTTAACAATTTTCTCCCTCCATCTGGCCGGGATTTCCTCGATTTTAGGGGCCATTAATTTTATTACAACTATTATTAACATGAAGCCCCCCGCTATCTCCCAATATCAAACCCCTCTGTTCGTATGGGCAGTCCTAATTACAGCCGTCCTCTTACTTCTCTCTCTCCCCGTCCTTGCAGCTGGAATCACTATATTACTTACAGACCGAAACCTTAATACCACCTTCTTCGACCCTGCAGGGGGAGGGGACCCCATYCTTTACCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because they are able to use many different habitats and food sources, and because they have large numbers of offspring, white perch are very common and do not have any special protection status.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lack of habitat restrictions, diversity of food sources, high fecundity rates, and generalist behavior white perch exhibit give them a competitive edge over many other species. They easily colonize new areas and utilize the available food sources better than native populations. Therefore, a need to has never arisen to protect M. americana. The species has no special conservation status, and its populations are doing quite well.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Warren et al. (2000) categorized the trend as "currently stable" in the southeastern United States.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations) (e.g., see map in Lee et al. 1980).

Total adult population size is unknown but presumably exceeds 100,000.

Warren et al. (2000) categorized the trend as "currently stable" in the southeastern United States.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because they are an invasive species in some areas, white perch may have negative effects on native fish that are economically important.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

White perch are important to humans as a source of food and recreational fishing. Many millions are caught each year, especially along the Atlantic coast from Massachusetts to North Carolina.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

As invasive piscivores, white perch have been implicated in changes to some Great Lakes fisheries, such as white bass and walleye.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These fish have become a favorite food source for humans. White perch are important both commercially and as a popular sport fish. The commercial industry is strongest from Massachusetts to North Carolina, being the most popular in the Chesapeake Bay area. No commercial fishing takes place in the northern and southern-most edges of their range. White perch harvest is accomplished by trawl, haul seines, and drift gill nets, and occurs all year, with the best results during the spring. In 1979, Maryland had the greatest harvest during a single year, yielding 563 metric tons of perch.

Sport fishing is popular in both marine and fresh waters throughout the species' range except in the gulf of Maine. Marine populations are most heavily utilized in Mid-Atlantic States, and an estimated 5,494,000 fish were caught by recreational fisherman in 1979. Freshwater sport fishing of white perch is most common in the northern portion of its range, where in 1979 Maine had an estimated catch of 60,175,000 and New Hampshire 664,000.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White perch

The white perch, Morone americana, is not a true perch but is, rather, a fish of the temperate bass family, Moronidae, notable as a food and game fish in eastern North America.

The name "white perch" is sometimes applied to the white crappie.

Generally silvery-white in color, hence the name, depending upon habitat and size specimens have begun to develop a darker shade near the dorsal fin and along the top of the fish. This sometimes earns them the nickname "black-back". White perch have been reported up to 49.5 cm (19.5 in.) in length and weighing 2.2 kg (4.8 lbs.).

Although favoring brackish waters, it is also found in fresh water and coastal areas from the St. Lawrence River and Lake Ontario south to the Pee Dee River in South Carolina, and as far east as Nova Scotia. They are also found in the lower Great Lakes and Chesapeake Bay. The raw meat is of a somewhat pinkish hue, but when cooked, it is white and flaky. At times, a parasite known as Lironeca ovalis is located in the gills. They are only known to reduce the growing rate of white perch.

Diet[edit]

White perch are known to eat the eggs of many species native to the Great Lakes, such as walleye and other true perches. At times, fish eggs are 100% of their diet. They prefer to eat small minnows like mud minnows and fathead minnows. In the Chesapeake Bay, white perch commonly prey upon grass shrimp, razor clams, and bloodworms which are all common to the region.

Reproduction[edit]

White perch are a prolific species. The female can deposit over 150,000 eggs in a spawning session, lasting just over a week. Several males will often attend a spawning female, and each may fertilize a portion of her eggs. The young hatch within one to six days of fertilization.

The white perch is currently recovering from a loss of population in the Hudson River.

Aquatic nuisance species[edit]

Some states consider the white perch to be a nuisance species due to its ability to destroy fisheries. They have been associated with the declines in both walleye and white bass populations because they feed heavily on baitfish used by those species and outcompete them for food and space. Many states have enacted laws forbidding possession of live white perch. Additionally, these states recommend not releasing captured white perch back into the water to help control its spread.

References[edit]

  1. ^ NatureServe 2013. Morone americana. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.2. <www.iucnredlist.org>. Downloaded on 15 February 2014.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly placed in the genus Roccus. The family Percichthyidae was recognized by Robins et al. (1991) as possibly polyphyletic but was retained for convenience.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!