Overview

Brief Summary

Bull trout (Salvelinus confluentus in the Salmonidae family) are cold-water fish of relatively pristine stream and lake habitats in western North America. There was a time when bull trout, like most salmonids, were wildly abundant in the six western states of Oregon, Washington, California, Nevada, Idaho and Montana. Today, they occur in less than half of their historic range, with scattered populations in portions of Oregon, Washington, Nevada, Idaho and Montana. In the Klamath River Basin, for example, bull trout occur in 21 percent of their historic range. They no longer exist in California. They were listed by the U.S. Fish and Wildlife Service as a threatened species throughout their range in 1999.

Compared to other salmonids, bull trout have more specific habitat requirements that appear to influence their distribution and abundance. They need cold water to survive, so they are seldom found in waters where temperatures exceed 59 to 64 degrees (F). They also require stable stream channels, clean spawning and rearing gravel, complex and diverse cover, and unblocked migratory corridors.

Bull trout may be distinguished from brook trout (Salvelinus fontinalis) by several characteristics: spots never appear on the dorsal (back) fin, and the spots that rest on the fish's olive green to bronze back are pale yellow, orange or salmon-colored. The bull trout's tail is not deeply forked as is the case with lake trout (Salvelinus namaycush).

Bull trout exhibit two forms: resident and migratory. Resident bull trout spend their entire lives in the same stream/creek. Migratory bull trout move to larger bodies of water to overwinter and then migrate back to smaller waters to reproduce. An anadromous form of bull trout also exists in the Coastal-Puget Sound population, which spawns in rivers and streams but rears young in the ocean.

Resident and juvenile bull trout prey on invertebrates and small fish. Adult migratory bull trout primarily eat fish. Resident bull trout range up to 10 inches long and migratory forms may range up to 35 inches and up to 32 pounds.

Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Biology

Occurs in deep pools of large cold rivers and lakes (Ref. 5723). Most common in high mountainous areas where snowfields and glaciers are present (Ref. 5723). Rarely anadromous (Ref. 5723, Ref. 51243). Lacustrine form matures in lakes and spawns in tributaries, where young reside for one to three years (Ref. 10367).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Salvelinus confluentus, also called the bull trout or inland dolly varden, is most closely associated with pristine mountainous areas of the northwestern United States and Canada where cold, clean waters flow. The geographic range of S. confluentus is confined to northwestern North America from Alaska to northern California (Bjornn, 1991). The species is generally considered to live within the Arctic, Pacific and Missouri River drainages in mountain and coastal streams (Page and Burr, 1991). More specifically, the southern limit of the species has historically been within the McCloud River drainage system of northern California. East of this limit, S. confluentus occurs in the Columbia River drainage in northern Nevada and north to the extreme southern Yukon Territory (Page and Burr, 1991). Some drainage systems in Montana, particularly the Flathead system located on the western slope of the continental divide, sustain S. confluentus as well. In the United States, Idaho, Nevada, Montana, Oregon and Washington all contain some native stocks of bull trout. In Canada, the provinces of British Columbia and Alberta have existent populations located on both sides of the Continental Divide (Nelson and Paetz, 1992).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) North-south distribution in coastal and montane areas of Pacific Northwest between about 48 and 61 degrees N latitude, north to the Yukon and Liard river drainages in northern British Columbia and adjacent Yukon Territory (Haas and McPhail 1991); occurs in most drainages on both sides of Continental Divide (Lee et al. 1980). Coastal and mountain streams of Arctic, Pacific, and Missouri River drainages from extreme southern Yukon through western Canada Washington, Idaho, Montana, and Oregon to the headwaters of Columbia River drainage in northern Nevada (Jarbridge River distinct population segment) and (formerly) the McCloud River drainage below Lower Falls in California (extirpated in California); locally common, rare in southern part of range; in the United States, extirpated from most of the large rivers that historically were occupied (California DF&G 1990, Page and Burr 1991).

Klamath River population segment occurs in south-central Oregon (USFWS 1997). Columbia River population segment occurs in Idaho, Montana, Oregon, Washington, and British Columbia (USFWS 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:

U.S.A, coterminous (lower 48 states)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal and mountain streams of Arctic, Pacific, and Missouri River drainages from extreme southern Yukon in Canada to headwaters of Columbia River drainage in northern Nevada, USA, and McCloud River drainage in northern California, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The bull trout, although similar in appearance, is not a true trout (Oncorhynchus sp.). Several characteristics differentiate them and likewise all of the char. The primary attributes that distinguish S. confluentus are the lack of teeth on the roof of the mouth and the presence of light spots on a dark background versus dark spots on a lighter background which true trout possess (Bjornn, 1991; USFWS, 1998). The general non-spawning coloration of the species is an olive to blue-gray back with some gray to silver tones on the fish's sides (Nelson and Paetz, 1992). Spot coloration can be red, yellow or orange and can often times be a combination of the three (Nelson and Paetz, 1992). Another trait that is often present and distinguishes the bull trout from other genera is the presence of a white margin on the leading edge of the ventral fins (Bjornn, 1991).

The species, as do all salmonids, display sexual dimorphism. In preparation for spawning, the breeding male can possess magnificent coloration that is characterized by red to orange lower sides and a belly of similar coloration. The appearance of the female is similar to the male during the non-spawning season but is generally more gray to silver in coloration. During the spawning period the female retains these colors with little or no change.

Individuals living in streams do not often grow larger than 4 kg, but the lake inhabitants, which have a longer migration to spawing sites, can acheive more than 9 kg (USFWS, 1998).

Range mass: 4-9 (high) kg.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 90 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

103 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 14.5 kg (Ref. 4699)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

S. confluentus is usually found in medium to large river systems but can also occur in large lakes and reservoirs when conditions are adequate. In the fluvial setting the bull trout favors deep pools where it usually sits on or near the bottom (Bjornn, 1991). In the lacustrine setting the species frequents the cold, deeper sections of lakes as well as the shallows. The particular location of Salvelinus confluentus within a lake is dependant on the time of year and water temperature. Within their habitat the species generally prefers temperatures below 50 degrees Fahrenheit (Bjornn, 1991).

Although most representatives of the species are of the inland form, some populations of bull trout are anadromous and can co-exist with dolly varden char along the coast. These bull trout begin life in tributaries draining to the ocean and spend only a short period of their juvenile life in the stream. After entering the marine environment they spend up to three years feeding and maturing. When sexual maturity is reached, they return to freshwater for the sole purpose of spawning.

Habitat Regions: freshwater

Terrestrial Biomes: forest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater; brackish
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes the bottom of deep pools in cold rivers and large tributary streams, often in moderate to fast currents with temperatures of 45-50 F; also large coldwater lakes and reservoirs. In the contiguous U.S., now extirpated in most large rivers that historically were inhabited; confined mostly to headwater streams. Conditions that favor the persistence of populations include stable channel, relatively stable stream flow, low levels of fine substrate sediments, high stream channel complexity with various cover types, temperatures not exceeding about 15 C, and the presence of suitable corridors for movement between suitable winter and summer habitats and for genetic exchange among populations (Rieman and McIntyre 1993).

Migratory forms live in tributary streams for up to several years before migrating downstream into a larger river or lake, where they spend several years before returning to tributaries to spawn (Rieman and McIntyre 1993). Some or most juveniles move to larger rivers or to a lake by mid-summer, while others stay in spawning areas for 2-4 years (Spahr et al. 1991). Adults return to river or lake after spawning in small streams. May move to lower reaches of mainstream river for winter. Resident populations often occur in small headwater streams where they spend their entire lives (see Rieman and McIntyre 1993). In lakes, inhabits all depths in fall, winter, and spring; moves to cooler, deeper water for summer.

Spawning usually occurs in gravel riffles of small tributary streams, including lake inlet streams. Spawning sites often are associated with springs (Rieman and McIntyre 1993). According to California Department of Fish and Game (1990), spawning requires a large volume of cold water. Optimum temperatures for incubation are about 2-4 C (see Rieman and McIntyre 1993). Constructs spawning redd. Young are closely associated with stream channel substrates (Rieman and McIntyre 1993). Areas with large woody debris and rubble substrate are important as juvenile rearing habitat (Spahr et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columbia River Benthopelagic Habitat

This taxon is one of a several benthopelagic species in the Columbia River system. Benthopelagic river fish are found near the river bottom, feeding on benthos and zooplankton. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The Columbia River Basin of northwestern North America is an important habitat for Acipenser transmontanus. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality in the Columbia River has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Some of the large benthopelagic native fish species in the Columbia are the 63 cm northern pikeminnow (Ptychocheilus oregonensis) and the 45 cm Tui chub (Gila bicolor).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.MIchael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.15 - 4.5

Graphical representation

Depth range (m): 0.15 - 4.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Two distinct forms, resident and migratory, exist throughout the range (Rieman and McIntyre 1993). Migratory form migrates between spawning and nonspawning habitats; migrates upstream to spawning areas in spring. Anadromy has not been documented but may have been important in the past (see Rieman and McIntyre 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

After departing from the spawning redd in spring the young bull trout begins looking for suitable habitat for protection and food sources. As a juvenile, the first year in the life of the bull trout is spent eating small aquatic invertebrates (Bjornn, 1991; USFWS, 1998). These aquatic larvae, often ephemeropterans or dipterans (Bjornn, 1991), are readily available in the lower water column and interstitial spaces that these juveniles inhabit. As the bull trout grows larger, their diet, in addition to aquatic invertebrates, consists of other fish species (Bjornn, 1991). This increased piscivorous behavior increases as the fish grows. Of all salmonids, namely the salmon and trout, S. confluentus is more inclined to feed on fish. In certain parts of their range the mountain whitefish (Prosopium williamsoni) comprise a large part of the bull trout diet (Bjornn, 1991). In addition to whitefish bull trout will feed on sculpins, darters or other trout and where applicable, salmon fry (USFWS, 1998).

Animal Foods: fish; insects

Primary Diet: carnivore (Piscivore , Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in deep pools of large cold rivers and lakes (Ref. 5723). Most common in high mountainous areas where snowfields and glaciers are present (Ref. 5723). Rarely anadromous (Ref. 5723). Lacustrine form matures in lakes and spawns in tributaries, where young reside for one to three years (Ref. 10367).
  • Wilhelm, F.M., B.R. Parker, D.W. Schindler and D.B. Donald 1999 Seasonal food habits of bull trout from a small alpine lake in the Canadian rocky mountains. Trans. Am. Fish. Soc. 128(6):1176-1192. (Ref. 42336)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats terrestrial and aquatic insects, macrozooplankton, mysids, and fishes. Young feed heavily on aquatic insects. Adults feed principally on fishes, but have also been known to eat other small vertebrates, including frogs, snakes, mice, ducklings, etc. (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In the natural and unaltered fluvial or lacustrine setting, S. confluentus does not have many predators. As would be assumed with juvenile or young fish, some predation could occur from piscivorous birds. The greatest threat to the species however is most likely other fish species, specifically introduced non- indigenous species. Other fishes, such as trout, that are introduced into a drainage can either prey on young bull trout or compete with them directly for food (Bjornn, 1991).

One particular scenario that has been documented occurred in Priest Lake, Idaho. In this instance both brook trout (S. fontinalis) and lake trout (S. namaycush) were introduced into the drainage. In tributaries feeding the lake, brook trout competed with young bull trout for food and in the lake, lake trout preyed on bull trout (Bjornn, 1991). This eventually took a toll on the bull trout population as this type of predation and competition prevents many from reaching maturity and subsequently reduces number of future spawning stock (Bjornn 1991).

Another threat to the preservation and viability of the bull trout is the incidence of capture by humans. Being easily caught by the angler makes the species quite vulnerable to overfishing (Bjornn, 1991).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Salvelinus confluentus is prey of:
Aves
Salvelinus namaycush

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Salvelinus confluentus preys on:
Actinopterygii
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Klamath River population segment comprises seven disconnected populations (USFWS 1997). Columbia River population segment comprises 386 populations (USFWS 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Resident and migratory form live together but whether they represent a single population or separate populations is unknown (Rieman and McIntyre 1993).

Vigorous populations may require abundant fish forage (Rieman and McIntyre 1993).

Available information indicates that bull trout and other native fishes use different resources, reducing direct competition (Rieman and McIntyre 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication Channels: visual ; acoustic

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The life cycle of the bull trout can be separated into five periods of development (Moyle and Cech, 2000). As with most salmonids the rate of development for bull trout embryos is primarily temperature driven(Bjornn, 1991). After egg deposition in the fall, relatively warm temperatures facilitate rapid embryonic development (Bjornn, 1991). These warmer temperatures, usually 40-50 degrees F, are followed by much colder winter temperatures that approach freezing and subsequently decrease the rate of embryonic development (Bjornn, 1991). As winter progresses into spring and temperatures increase, the rate of development is again increased.

The first developmental period is the embryonic stage in which the fish's growth is reliant on the yolk sac. The embryonic stage can be further broken down. The first part of the embryonic period is the cleavage stage and is accepted to be the time between the first occurrence of cell division and the development of pre-organ systems (Moyle and Cech, 2000). This is followed by the embryo stage in which the organs are formed (Moyle and Cech, 2000). This stage ends with hatching, at which time the animal is no longer confined to the shape of the egg. Most bull trout throughout the range hatch from the egg between 100-120 days. The free-embryo stage follows and is the period in which the fish is still dependent on the protein of the egg sac but is more fish-like in nature (Moyle and Cech, 2000).

The larval period of S. confluentus is not unlike other salmonids in that at this time the fish leaves the spawning site and begins to feed on it's own. In mid spring, after the larval fish has absorbed its yolk sac, it emerges from the redd as an alevin and proceeds to find suitable habitat for the summer period. This usually occurs 200-230 days after spawning (Bjornn, 1991).

The juvenile period follows the larval period and is generally demarcated by the presence of fully formed organ systems and fins (Moyle and Cech, 2000). Other than coloration, the bull trout at this stage is essentially a miniscule version of the adult form (Moyle and Cech, 2000).

With the maturation of bull trout, gonads are fully capable of performing sexual reproduction and the fish is considered to be in the adult stage. Behavioral changes in the species and the development of spawning colors are characteristic of this stage (Moyle and Cech, 2000).

The senescent period which is the last and final stage in the life of bull trout as well as other salmonids occurs when the fish is sexually degenerative. With the onset of this period of "old age" the fish has essentially stopped growing (Moyle and Cech, 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The lifespan and longevity of the bull trout is not well documented but seems to be approximately 10-12 years (USFWS, 1998). In the lacustrine setting, where the species attains much greater size, it would seem that bull trout would have a longer lifespan.

Average lifespan

Status: wild:
10-12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Salvelinus confluentus, whether in a lake or stream setting, become sexually mature between four and ten years old (Bjornn, 1991; USFWS, 1998). Bull trout begin to spawn in the late part of August or early September and often lasting through October (Bjornn, 1991). Spawning times for specific populations is governed largely by water temperature. Generally, however, spawning activities are triggered when the water temperature drops below 10 degrees Centigrade (Bjornn, 1991).  Many populations of bull trout are migratory in nature whether they are of the lake or river form. Those population segments living in lakes will migrate up natal rivers as spawning is not possible in still water. Those segments that are river dwelling will often migrate within the system from smaller headwaters to larger mainstream sections of river (Bjornn, 1991).

As is typical of all trout and salmon, the female, after finding a suitable spawning area, fans a section of gravel substrate thereby producing a large depression in the stream bed. After this process is complete a male bull trout (usually only one) will fertilize eggs deposited by the female. Depending on the size of the individual, fecundity can vary. For average size bull trout around 5000 eggs can be typical (Nelson and Paetz, 1992), however many more can be found in larger specimens and some bull trout in the fifteen pound range have been documented as having approximately 12,000 eggs (Bjornn, 1991).

It is possible for male bull trout to spawn with more than one female. Although the species is not monogamous, some evidence has been documented that male and female bull trout can pair up during migration (Bjornn, 1991).

Range number of offspring: 200 to 12,000-13,000.

Average number of offspring: 5000.

Range gestation period: 100 to 120 days.

Average age at sexual or reproductive maturity (female): 4-10 years.

Average age at sexual or reproductive maturity (male): 4-10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in late summer or fall, with falling temperatures between 5 C and 9 C. Eggs hatch in late winter or early spring. Fry emerge from gravel in April or May. Most information indicates that sexual maturity is attained in 5-7 years (also reported as 4-5 years). May spawn each year or in alternate years. Spawning populations may comprise four or more year classes, though one or two year classes may dominate. See Rieman and McIntyre (1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Energy boost from vortices: bull trout
 

Bodies of fish decrease energy required for locomotion by using vortices.

   
  "Researchers are studying how fish use surrounding vortices to provide an energy boost. Vortices can come from other fish or stationary objects. Conventional wind turbines need a steady wind, so use of eddies would require a new design. Vortices in water alternately spin clockwise and counter-clockwise. Similarly, a wind turbine that uses eddies caused by buildings would need to be able to adjust to varying angles. Dabiri has developed prototypes for both air and water. While they may produce less energy than a wind turbine, they can work over a longer period so the net energy produced per year should be similar." (Courtesy of the Biomimicry Guild)

"Aquatic animals swimming in isolation and in groups are known to extract energy from the vortices in environmental flows, significantly reducing muscle activity required for locomotion. A model for the vortex dynamics associated with this phenomenon is developed, showing that the energy extraction mechanism can be described by simple criteria governing the kinematics of the vortices relative to the body in the flow. In this way, we need not make direct appeal to the fluid dynamics, which can be more difficult to evaluate than the kinematics. Examples of these principles as exhibited in swimming fish and existing energy conversion devices are described. A benefit of the developed framework is that the potentially infinite-dimensional parameter space of the fluid–structure interaction is reduced to a maximum of eight combinations of three parameters. The model may potentially aid in the design and evaluation of unsteady aero- and hydrodynamic energy conversion systems that surpass the Betz efficiency limit of steady fluid dynamic energy conversion systems." (Dabiri 2007:L1)

Watch videos

"Fishes moving through turbulent flows or in formation are regularly exposed to vortices. Although animals living in fluid environments commonly capture energy from vortices, experimental data on the hydrodynamics and neural control of interactions between fish and vortices are lacking. We used quantitative flow visualization and electromyography to show that trout will adopt a novel mode of locomotion to slalom in between experimentally generated vortices by activating only their anterior axial muscles. Reduced muscle activity during vortex exploitation compared with the activity of fishes engaged in undulatory swimming suggests a decrease in the cost of locomotion and provides a mechanism to understand the patterns of fish distributions in schools and riverine environments." (Liao et al. 2003:1566)

Note: Studies were on trout, not specifically bull trout.
  Learn more about this functional adaptation.
  • Dabiri, J. O. 2007. Renewable fluid dynamic energy derived from aquatic animal locomotion. BIOINSPIRATION AND BIOMIMETICS. 2(3): 1.
  • Liao, J. C.; Beal, D. N.; Lauder, G. V.; Triantafyllou, M. S. 2003. Fish Exploiting Vortices Decrease Muscle Activity. Science. 302(5650): 1566.
  • Whittlesey RW; Liska S; Dabiri JO. 2010. Fish schooling as a basis for vertical axis wind turbine farm design. BioInspiration and Biomimetics. 5(3):
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Salvelinus confluentus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCCCTTAGCCTCTTGATTCGGGCAGAGTTAAGCCAACCCGGAGCTCTTCTAGGGGATGACCAGATCTATAACGTAATCGTAACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATACCAATTATGATCGGGGGCTTTGGAAACTGATTAATCCCTCTAATAATTGGGGCCCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCACCGTCCTTTCTCCTTCTCCTGGCTTCGTCAGGGGTTGAAGCTGGCGCCGGTACGGGGTGGACAGTCTACCCCCCTCTAGCCGGGAACCTCGCCCACGCAGGGGCCTCCGTTGATTTAACTATCTTCTCCCTTCATTTAGCTGGCATTTCCTCAATTTTGGGGGCCATTAACTTTATCACAACCATTATTAACATGAAGCCCCCAGCTATTTCTCAATATCAAACCCCGCTTTTTGTTTGAGCTGTCTTAGTTACTGCTGTCCTTTTGTTACTTTCCCTCCCCGTTCTAGCAGCAGGCATTACTATGTTACTCACGGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGAGGGGACCCAATTTTATACCAGCACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Salvelinus confluentus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Over the past century habitat degradation, introduction of non-native fishes and overfishing has caused the bull trout to become threatened across most of its range (Bjornn, 1991). S. confluentus is currently extinct in California with all of the native stock gone (USFWS 1998). Throughout its range, bull trout have been extirpated from many streams once inhabited by the species (Bjornn, 1991). Viable populations do exist, but the population density of the species has been severely diminished.

It is imperative at this stage that measures continue to be taken to ensure the future of S. confluentus as a unique, indigenous western species. Some steps have already been implemented to reduce mortality, such as habitat restoration and protection, catch and release fishing in some areas, and prohibitions on fishing in others.

Habitat degradation, facilitated largely through increased siltation due to unsound land use practices needs to be further curtailed. The bull trout is highly intolerant of polluted waters and likewise requires the coldest and cleanest water of all salmonids (USFWS, 1998). Implementation of better land use practices in or around drainages that contain bull trout are vital to the existence of the species. According to the IUCN red list the species is vulnerable and has seen a decline of at least 20% over the last ten years, primarily for the reasons stated above. A reduction of an additional 20% is projected for the next ten years if the current trend continues (IUCN, 2000).

In some areas where populations have been affected by anthropogenic impacts, bull trout culture in hatcheries could prove to be a successful means of restoring the population (Bjornn, 1991).

US Federal List: threatened

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2e

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Gimenez Dixon, M.

Reviewer/s

Contributor/s

History
  • 1994
    Indeterminate
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Ranges from extreme southern Yukon to northern California and northern Nevada; greatly reduced in range and numbers south of Canada, but many occurrences remain in the core of the range; many streams contain exotic congeners that compete for spawning females; trend over the past 10 years or three generations is relatively stable in the major portion of the range in British Columbia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/10/1998
Lead Region:   Pacific Region (Region 1)   
Where Listed: U.S.A., conterminous, lower 48 states

Status: Experimental Population, Non-Essential
Date Listed: 12/09/2009
Lead Region:   Pacific Region (Region 1)   
Where Listed: Clackamas River subbasin experimental population


Population detail:

Population location: Clackamas River subbasin and the mainstem Willamette River, from Willamette Falls to its points of confluence with the Columbia River, including Multnomah Channel
Listing status: EXPN

Population location: U.S.A., conterminous, (lower 48 states)
Listing status: T

For most current information and documents related to the conservation status and management of Salvelinus confluentus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is relatively stable in the major portion of the range in British Columbia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Hybridization appears to be a common problem where isolated or remnant resident populations overlap with introduced brook trout (spawning times and conditions are similar). Brook trout have been widely introduced and now occupy most basins inhabited by bull trout, though they often occupy different streams or stream reaches. Hybrids are likely to be sterile and experience developmental problems, and sometimes sharp declines in bull trout populations have occurred (Leary et al. 1993). In Montana, introduced brook trout progressively depressed a bull trout population. See Rieman and McIntyre (1993). In western Montana, Kanda et al. (2002) found that F1 hybrids can reproduce but they found no evidence of hybrid swarms in which all individuals are of hybrid origin. Because hybridization generally involved female bull trout and male brook trout, they concluded that hybridization represents greater wasted reproductive effort for bull trout than for brook trout.

Introduced brown trout and rainbow trout have been associated with bull trout declines, apparently due to competitive interactions; lake trout may have a negative impact on bull trout, due to predation by lake trout on juvenile bull trout, probable competitive interactions, and increased harvest associated with increased fishing pressure for lake trout (see Rieman and McIntyre 1993). Lake trout can displace bull trout and may prevent bull trout from becoming established in certain low elevation lakes (Donald and Alger 1993).

Stocked, hatchery-reared steelhead that do not migrate to the ocean (residual steelhead) sometimes migrate over 12 km upstream from their release point and may move into areas occupied by threatened stocks of bull trout (McMichael and Pearsons 2001). Residual steelhead could pose a threat through ecological interactions.

Bull trout are threatened by activities that damage riparian areas and cause stream siltation; logging, road construction, mining, and overgrazing may be harmful to spawning habitat. This species is very sensitive and severely impacted by siltation of spawning streams. Timber harvest and associated activities may have negative impacts on stream channels through sedimentation and/or increasing flooding or scour events (Rieman and McIntyre 1993).

Habitat fragmentation may be a problem, but it is unclear whether the fragmented distribution is natural due to specific habitat requirements or caused by human impacts (Rieman and McIntyre 1993). Some migratory populations have been virtually eliminated by water diversions or habitat disruption (e.g., in the Bitterroot basin) (Rieman and McIntyre 1993).

Passage through screens of water diversion structures has been a problem in some areas, but currently specified screen regulations for Pacific Northwest salmonid fry apparently do not need to be modified for bull trout fry (Zydlewski and Johnson 2002).

Climate change (warming) is a potential threat because it would decrease the amount of suitable habitat (see Rieman and McIntyre 1993).

Extirpation in California probably resulted from two factors: 1) interaction with the introduced brown trout, and 2) indirect effects resulting from the loss of the McCloud River spawning population of chinook salmon; loss of the massive influx of nutrients provided by dying salmon altered the character of the stream (Minckley and Deacon 1991).

Overharvest and illegal harvest are past and present threats, contributing to population reductions and threatening existing small populations. In response, Idaho, Montana, Oregon, and Washington have instituted strict harvest guidelines.

Electrofishing can be harmful to individual survival and reproduction (see management section).
In the Klamath River basin, bull trout are threatened by habitat degradation caused by livestock grazing, timber harvest, and water withdrawals; drought has aggravated the situation and existing land and water management and regulatory mechanisms have failed to protect populations and habitat; non-native brook trout also are a serious threat because of possible hybridization and competition; probably fewer than 5000 individuals remain in 7 fragmented populations (Fisheries Action News, Winter 1994). Each of the seven populations is at a moderate to high risk of extirpation (USFWS 1997).

Columbia River population segment is threatened by habitat degradation, passage restrictions at dams, and competition from non-native lake and brook trout.

For further information, see the threats section for individual population segments of bull trout.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2e)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Management efforts should include (1) habitat improvement such as the creation of instream structures that provide pockets of slow water favorable to juveniles and (2) protection from introduced brook trout (Spahr et al. 1991). See Thomas et al. (1993) for information on habitat management for this and other at-risk fish species in the Pacific Northwest.

Based on reproduction by F1 hybrids, Kanda et al. (2002) concluded that it would be appropriate to remove brook trout and brook trout/bull trout hybrids from streams occupied by bull trout.

A draft recovery plan for three of the five distinct population segments (Klamath, Columbia, and St. Mary-Belly Rivers) was available in late November 2002 (http://pacific.fws.gov). Recovery will require reducing threats to long-term population persistence, maintaining multiple interconnected populations across diverse habitats, and preserving the diversity of life-history strategies (e.g., resident or migratory forms, emigration age, spawning frequency, local habitat adaptations). See the draft recovery plan for further details.

Rieman and Allendorf (2001) concluded that cautious long-term management goals for bull trout populations should include an average of at least 1,000 adults spawning each year. Where local populations are too small, managers should seek to conserved a collection of interconnected populations that is at least large enough in total to meet this minimum (Rieman and Allendorf 2001). Also, full expression of life history variation and the natural processes of dispersal and gene flow should be provided (Rieman and Allendorf 2001).

Management Research Needs: Rieman and McIntyre (1993) listed the following research priorities: determine the range of conditions (especially temperature) tolerated by stable populations; determine the role of habitat disruption in the displacement of bull trout by brook trout; determine the effects of constructing barriers to limit the expansion of brook trout; investigate metapopulation structure and dynamics and dispersal; investigate the role of environmental variation in local extinction risk; investigate the role of the resident and migratory forms in population persistence, and determine the interactions between these forms; explore simulation methods for estimating extinction risks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected in Glacier National Park and Bob Marshal Wilderness, but brook trout, and habitat degradation outside these areas, still pose threats. Special rule allows for take of bull trout within the Columbia River population segment if in accordance with applicable state fish and wildlife conservation laws and regulations (USFWS 1997).

For the Klamath River distinct population segment (DPS), USFWS (2002) proposed critical habitat in approximately 476 kilometers (296 miles) of streams and 13,735 hectares (33,939 acres) of lakes and marshes in Oregon. For the Columbia River DPS, the proposed critical habitat designation totals approximately 29,251 km (18,175 mi) of streams and 201,850 ha (498,782 ac) of lakes and reservoirs, which includes: approximately 14,416 km (8,958 mi) of streams and 83,219 ha (205,639 ac) of lakes and reservoirs in the State of Idaho; 5,341 km (3,319 mi) of streams and 88,051 ha (217,577 ac) of lakes and reservoirs in the State of Montana; 5,460 km (3,391 mi) of streams and 18,077 ha (44,670 ac) of lakes and reservoirs in the State of Oregon; and 4,034 km (2,507 mi) of streams and 12,503 ha (30,897 ac) of lakes and reservoirs in the State of Washington.

Needs: "Conservation of bull trout will require maintenance or restoration of multiple, high-quality, connected habitats distributed throughout conservation areas, which in turn should be distributed throughout the species' range" (Rieman and McIntyre 1993). Effective conservation of the species and its inherent diversity requires an interregional appoach (Rieman and McIntyre 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

None known

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

None known

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

gamefish: yes; aquarium: public aquariums
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bull trout

The bull trout (Salvelinus confluentus) is a char of the family Salmonidae native to northwestern North America.[2] Historically, S. confluentus has been known as the "Dolly Varden" (S. malma), but was reclassified as a separate species in 1980.[3] Bull trout are listed as a threatened species under the U.S. Endangered Species Act (1998)[4] and as vulnerable on the IUCN Red List of Threatened Species.[5]

Description[edit]

Like other species of char, the fins of a bull trout have white leading edges. Its head and mouth are unusually large for salmonids, giving it its name. Bull trout have been recorded measuring up to 103 cm (41 in) in length and weighing 14.5 kg (32 lb).[2] Bull trout may be either migratory, moving throughout large river systems, lakes, and the ocean, or they may be resident, remaining in the same stream their entire lives.[4] Migratory bull trout are typically much larger than resident bull trout, which rarely exceed 2 kg (4.4 lb).[3] Bull trout can be differentiated from brook trout (S. fontinalis) by the absence of distinct spots on the dorsal fin, as well as yellow, orange, or salmon-colored spots on the back as opposed to red spots with blue halos on the brook trout. Bull trout lack the deeply forked tail fin of lake trout (S. namaycush, another char).[4]

Distribution and habitat[edit]

Core distribution of bull trout (Salvelinus confluentus) in U.S. 2005[6]

S. confluentus is found in the cold, clear waters of the high mountains and coastal rivers of northwestern North America, including Yukon, British Columbia, Washington, Oregon, Idaho, and western Montana, as well as the Jarbidge River of northern Nevada.[3][4] A population of bull trout exists east of the Continental Divide in Alberta, where it is the provincial fish. The historical range of bull trout also included northern California, but they are likely extirpated.[7]

Bull trout have exacting habitat demands, requiring water temperatures generally below 55°F (13°C), clean gravel beds, deep pools, complex cover such as snags and cut banks, and large systems of interconnected waterways to accommodate spawning migrations.[7] Thus, they favor the deep pools of cold lakes and large rivers, as well as high, cold mountain headwaters. Bull trout may be anadromous in coastal rivers, and individual bull trout have been found to have migrated from one coastal river to another by the ocean.[8]

Feeding[edit]

Young bull trout feed on zooplankton and zoobenthos, especially chironomids. As they grow larger, they begin to feed heavily upon other fish. In coastal Washington, some of the southernmost populations of bull trout feed heavily on salmon eggs and fry, as well as fish.

Conservation[edit]

Bull trout sign at Lake Pend Oreille in Idaho

The bull trout is listed as a threatened species under the U.S. Endangered Species Act throughout its range in the contiguous United States.[4] It is used as a management indicator species for several national forests, including Boise National Forest and Sawtooth National Forest (Sawtooth National Recreation Area). They can also be found in the Glacier National Park.[9] Bull trout reproduction requires cold water and very low amounts of silt, both of which are negatively impacted by road building and logging. Additionally, its need to migrate throughout river systems may be hindered by impassible fish barriers, such as dams.[8] Bull trout populations are also in danger from hybridization with non-native brook trout.[7]

They are a prized game fish in northern Canada. Indeed, the fish was once maligned out of fear they threatened populations of other native species more prized by anglers. Some jurisdictions publicize the requirement to release with the slogan "No black, put it back".[10]

Historical names[edit]

Fisherman with a big bull trout

"Dolly Varden" in California[edit]

Historically, confusion has existed between S. confluentus and Salvelinus malma malma, today commonly called the Dolly Varden trout. This was likely due to overlapping ranges and similar appearances among members of the two species.

The first recorded use of the name "Dolly Varden" for a fish species was applied to members of S. confluentus caught in the McCloud River in northern California in the early 1870s. In his book Inland Fishes of California, Peter Moyle recounted a letter from Mrs. Valerie Masson Gomez:

My grandmother's family operated a summer resort at Upper Soda Springs on the Sacramento River just north of the present town of Dunsmuir, California. She lived there all her life and related to us in her later years her story about the naming of the Dolly Varden trout. She said that some fishermen were standing on the lawn at Upper Soda Springs looking at a catch of the large trout from the McCloud River that were called 'calico trout' because of their spotted, colorful markings. They were saying that the trout should have a better name. My grandmother, then a young girl of 15 or 16, had been reading Charles Dickens' Barnaby Rudge in which there appears a character named Dolly Varden; also, the vogue in fashion for women at that time (middle 1870s) was called 'Dolly Varden', a dress of sheer figured muslin worn over a bright-colored petticoat. My grandmother had just gotten a new dress in that style and the red-spotted trout reminded her of her printed dress. She suggested to the men looking down at the trout, 'Why not call them "Dolly Varden"?' They thought it a very appropriate name and the guests that summer returned to their homes (many in the San Francisco Bay area) calling the trout by this new name. David Starr Jordan, while at Stanford University, included an account of this naming of the Dolly Varden trout in one of his books.

In 1874, Livingston Stone, a naturalist working for the U.S. government, wrote of this fish:[11]

Also called at (Upper) Soda Springs the 'Varden' trout. … The handsomest trout, and, on the whole, having the most perfect form of all the trout we saw on the McCloud. Also, the only fish that had colored spots. This one was profusely spotted over most of the body with redish [sic?] golden spots. ... The local name at (Upper) Soda Springs is the Dolly Varden.

It is currently unknown whether the name "Dolly Varden" was later applied to S. m. malma because of its similar appearance to S. confluentus; the two may have even been believed to be the same species. The name "Dolly Varden" may have also been given to S. m. malma independent of the McCloud River fish.

Ironically, the original "Dolly Varden" trout (i.e., S. confluentus)apparently likely became locally extinct in the McCloud River in the 1970s, although reports continue of its being caught. Other fish species, typically introduced trout, outcompete S. confluentus, and can interbreed with them, resulting in sterile hybrids. An attempt to reintroduce S. confluentus to the McCloud was unsuccessful, and no additional attempts are expected.[12]

Other uses of "Dolly Varden"[edit]

The "Dolly Varden" name is also applied to the other subspecies of S. malma, the S. m. krascheninnikova, and S. m. miyabei, found on the island of Hokkaidō in Japan.[13]

The name has also been applied to S. alpinus, today more commonly known as Arctic char.

"Bull trout" in Europe[edit]

The name "bull trout" was also given in the past to some of the large sea trout that run the River Tweed and other rivers in Scotland and North East England. Victorian anglers and others classified these as a separate race, but today they are biologically classified along with all other UK brown and sea trout as Salmo trutta. This does not deny that populations of S. trutta can differ appreciably in habits, size, and appearance from place to place, or indeed in the same river or lake.

References[edit]

  1. ^ "Salvelinus confluentus". Integrated Taxonomic Information System. Retrieved 24 January 2006. 
  2. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Salvelinus confluentus" in FishBase. May 2009 version.
  3. ^ a b c U.S. Fish and Wildlife Service Bull Trout Facts
  4. ^ a b c d e "Species Profile-Bull trout (Salvelinus confluentus)". US Fish and Wildlife Service. Retrieved 2014-05-21. 
  5. ^ Gimenez Dixon, M. (1996). "Salvelinus confluentus". IUCN Red List of Threatened Species. Version 2.3. International Union for Conservation of Nature. Retrieved 1996-08-01. 
  6. ^ "Map C - Core Area By Distribution" (pdf). US Fish and Wildlife Service. 2005. 
  7. ^ a b c Washington's Native Chars, Washington Department of Fish and Wildlife
  8. ^ a b Ecology of the Bull Trout at the Wayback Machine (archived August 18, 2000), King County, Washington
  9. ^ "Preservation of Threatened Bull Trout in Glacier National Park". USGS. Retrieved 2013-09-24. 
  10. ^ "The bull trout has no black on its dorsal fin". Bull Trout Identification & Education Program. Montana Fish Wildlife and Parks Dept. Retrieved 10 February 2012. 
  11. ^ VI. Report of Operations During 1872 at the United States Salmon-Hatching Establishment on the M’Cloud River, and on the California Salmonidae generally; with a list of Specimens Collected. By Livingstone Stone. In: United States Commission of Fish and Fisheries. Part II. Report of the Commissioner for 1872 and 1873. A- Inquiry into the Decrease of the Food Fishes. B- The Propagation of Food-Fishes in the Waters of the United States. With Supplementary Papers. Washington: Government Printing Office, 1874 at pp. 203 - 207.
  12. ^ Detailed history of Dolly Varden/Bull trout on McCloud River
  13. ^ Use of Dolly Varden name in Japan
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The bull trout is a member of the S. alpinus complex. It was long confused with look-alike S. malma (Dolly Varden), especially where the ranges overlap on the Pacific slope (Lee et al. 1980). McPhail (1961) regarded S. confluentus as conspecific with S. malma. Cavender (1978) demonstrated the specific distinctiveness of S. confluentus, but hybridization and some introgression occur across a broad area of contact. Additionally, molecular data indicate that historical introgression of bull trout mtDNA into Dolly Varden occurred sometime prior to the most recent glaciation (Redenbach and Taylor 2002).

Genetic studies by Allendorf at the Univeristy of Montana suggest that Klamath River basin populations may be distinctive; further study of variation is needed (Starnes 1995).

Genetic studies suggest that the bull trout comprises two or more clades that originated from distinct glacial refugia on either side of the Cascade/Coast Mountains (see review in Costello et al. 2003). Genetic data indicate that bull trout tend to show high levels of population subdivision in localized areas; hence local populations likely have high levels of demographic independence (Costello et al. 2003). Bull trout exhibit apparently low levels of intrapopulation molecular variation (Costello et al. 2003).

Sterile hybrids arise from cross with S. fontinalis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!