Overview

Comprehensive Description

Biology

Inhabit rubble and gravel riffles (sometimes runs and pools) of fast creeks and small to medium rivers; also in rocky shores of lakes (Ref. 5723). Young up to 4 months are pelagic (Ref. 1998). Form schools (Ref. 1998). Feed on mayflies, blackflies, and midges (Ref. 1998). Spawn over pits in loose gravel substrate (Ref. 51972). Widely used as bait in the USA (Ref. 1998). Artificially propagated in Minnesota, USA in long narrow ponds having weak water flow (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Widest range of any North American minnow; generally distributed north of 40 degrees north latitude from coast to coast; north to the Arctic Circle in the Mackenzie River drainage; south in the Appalachian Mountains to northern Georgia, south through the Rocky Mountains into the Rio Grande drainage of Texas and northern Mexico, and south along the Atlantic coast to Virginia; common in northern U.S., fairly common in west but absent from Alaska and from western drainages south of the Columbia and Coos river drainages (Page and Burr 1991). Subspecies cataractae: east of the Continental Divide. Subspecies dulcis: Pacific basin. Subspecies SMITHI: formerly in hot springs in Banff National Park, Alberta.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Widest range of any North American minnow; generally distributed north of 40 degrees north latitude from coast to coast; north to the Arctic Circle in the Mackenzie River drainage; south in the Appalachian Mountains to northern Georgia, south through the Rocky Mountains into the Rio Grande drainage of Texas and northern Mexico, and south along the Atlantic coast to Virginia; common in northern U.S., fairly common in west but absent from Alaska and from western drainages south of the Columbia and Coos river drainages (Page and Burr 1991). Subspecies cataractae: east of the Continental Divide. Subspecies dulcis: Pacific basin. Subspecies SMITHI: formerly in hot springs in Banff National Park, Alberta.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: widely occurs from coast to coast of north-central North America: in the east along the mountains to Virginia; in the Mississippi drainage south to Iowa; in the western basin south to northern Mexico; reported from northeastern Nevada; in the inshore waters in all the Great Lakes (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Longnose dace (Rhinichthys cataractae) have the widest geographic distribution of any member of the Cyprinidae family (Jenkins and Burkhead, 1994). The distribution spans much of North America, ranging from the Atlantic coast to the Pacific Ocean and from northern Mexico to the Arctic Circle in northern Canada.

Biogeographic Regions: nearctic (Introduced , Native )

  • Jenkins, R., N. Burkhead. 1994. Freshwater fishes of Virginia. Bethesda, Maryland: American Fisheries Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; including northern Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 40 - 42
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Longnose dace are typically dark olive-brown with a lighter yellow-tan venter (Page and Burr, 1991). A dark lateral stripe, present in juveniles, fades as the fish matures. This is a good distinguishing characteristic between longnose dace and their close relatives, blacknose dace (Rhinichthys atratulus), which maintain their dark lateral stripe throughout their lifetime (Page and Burr, 1991). Other identifying characteristics include a sub-terminal mouth with a fleshy snout projecting far beyond the mouth. A small barbel is also present near the corner of the mouth (Goldstein and Simon, 1999). Total length is largely based on local habitat conditions; adults are usually 60 to 90 mm in length (Sigler and Miller, 1963) and reported maximum sizes are around 160 mm for stream dwelling individuals, slightly larger for lake-dwelling longnose dace (Page and Burr, 1991; Brazo, Liston, and Anderson, 1978). Longnose dace have been reported to get up to 225 mm in total length (Gerald 1966).

Range length: 60 to 225 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Gerald, J. 1966. Food Habits of the Longnose Dace, Rhinichthys cataractae. Copeia, 3: 478-485.
  • Goldstein, R., T. Simon. 1999. Toward a united definition of guild structure for feeding ecology of North American freshwater fishes.. New York, New York: CRC Press.
  • Page, L., B. Burr. 1991. A Field Guide to Freshwater Fishes : North America North of Mexico (Peterson Field Guides). Boston, Massachusetts: Houghton Mifflin Company.
  • Sigler, W., R. Miller. 1963. Fishes of Utah. Salt Lake City: Utah State Deptartment of Fish Game.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 8 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 178 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

22.5 cm TL (male/unsexed; (Ref. 51971)); max. reported age: 5 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Absence of a groove between the upper lip and tip of snout. Barbel present. Snout long and overhanging.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Rhinichthys cataractae
Catalog Number: USNM 20225
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): Bowman
Locality: Sweet Water Fork, Platte R., United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Rhinichthys cataractae
Catalog Number: USNM 52
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): Bowman
Year Collected: 1853
Locality: Platte Sweet Water (Nebraska), Nebraska, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Characteristic of clean, swiftly flowing, gravel or bouldery creeks and small to medium rivers; also in inshore waters of lakes over gravel or boulder bottoms. May move offshore to deeper water in summer in warm lakes. Rests under stones when inactive. Spawns probably in riffles over a gravelly bottom, sometimes over or near river chub nests. Also spawns in shallow, pebble-bottomed, wave-swept shorelines of lakes. Fry occupy quiet shallow protected margins of streams, move into swift water within 6 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Characteristic of clean, swiftly flowing, gravel or bouldery creeks and small to medium rivers; also in inshore waters of lakes over gravel or boulder bottoms. May move offshore to deeper water in summer in warm lakes. Rests under stones when inactive. Spawns probably in riffles over a gravelly bottom, sometimes over or near river chub nests. Also spawns in shallow, pebble-bottomed, wave-swept shorelines of lakes. Fry occupy quiet shallow protected margins of streams, move into swift water within 6 weeks.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 7.0; dH range: 10 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of longnose dace use different niches based on local habitat conditions. Different habitat availability as well as the presence or absence of competing species drives populations into different patterns of niche use. Longnose dace are found in fast-flowing, cold water. Most populations are found in stream riffles. When in lakes, they are typically in the turbulent surge zone less than 10 m deep, where outflow from a river mixes with lake water (Brazo, Liston, and Anderson, 1978). Another characteristic of longnose dace habitat is rocky or gravel substrate (McPhail and Lindsey, 1970; Cooper, 1980). Brazo et al. (1978) reported similar substrate preferences in lake-dwelling populations, where longnose dace prefer gravel substrates over sandy habitats. Streams they inhabit tend to be small creeks and rivers with shallow pools as well as an abundance of fast-flowing riffles; similar to "trout streams" (Reed, 1959). Young longnose dace are found in shallow pools for the first four months following hatching (Reed 1959). Pools are also used by adults in the absence of competing species (Edwards, Li, and Schreck, 1983).

Range depth: <1 to 10 m.

Average depth: <1 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams

  • Brazo, D., C. Liston, R. Anderson. 1978. Life History of the Longnose Dace, Rhinichthys cataractae, in the Surge Zone of Eastern Lake Michigan Near Ludington, Michigan. Trans. Am. Fish. Soc., 107(4): 550-556.
  • Cooper, J. 1980. Egg, Larval and Juvenile Development of Longnose Dace, Rhinichthys cataractae, and River Chub Nocomis micropogon with Notes on Their Hybridization. Copeia, 3: 469-478.
  • Edwards, E., H. Li, C. Schreck. 1983. Habitat suitability index models: Longnose dace. U.S. Dept. Int., Fish Wildl. Serv., FWS/OBS-82/10: 13.
  • McPhail, J., C. Lindsey. 1970. Freshwater fishes of northwestern Canada and Alaska. Bull. Fish. Res. Board Can., 173: 1-373.
  • Reed, R. 1959. Age, growth, and food of the longnose dace, Rhinichthys cataractae, in northwestern Pennsylvania. Copeia, 1959: 160-162.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 230 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.075 - 7.5

Graphical representation

Depth range (m): 0.075 - 7.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly benthic insects, especially Diptera and mayflies (Becker 1983, Scott and Crossman 1973); also eats algae and plant material (Sublette et al. 1990). Terrestrial insects and fish egs common in diet of adults from Lake Michigan (see Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabit very turbulent waters; also occur inshore waters of lakes; in warm lakes, may move offshore into deep water during the heat of summer; may eat fish eggs (Ref 1998). Young up to 4 months are pelagic (Ref. 1998). Form schools (Ref. 1998). Insectivorous (Ref. 10294, 54729). Feed on mayflies, blackflies, and midges (Ref. 1998, 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Longnose dace are primarily nocturnal feeders (Brazo, Liston, and Anderson, 1978). This nocturnal foraging strategy is different from most cyprinids, but Rhinichthys cataractae is well adapted for this method (Beers and Culp, 1990). Longnose dace have dark-adapted vision for night foraging. Beers and Culp (1990) studied how changes in light intensity changed foraging efficiency when predators were removed. All factors indicative of foraging ability were greatest under low light conditions, such as around dusk. However, most foraging occurs at night where they are slightly less efficient. Therefore, this nocturnal strategy is thought to be a combination of minimizing predation risks while still increasing efficiency in low-light conditions (Beers and Culp, 1990).

Longnose dace are well adapted for feeding on bottom dwelling insects (Gerald, 1966). At night, they use benthic-rooting behavior; it is thought they locate prey by olfaction using their barbels to probe into the substrate (Beers and Culp, 1990). Brazo et al. (1978) determined through stomach analysis that longnose dace depend primarily on invertebrates as their primary food source. As in previous studies, their invertebrate diet consisted of midges, black flies, and mayflies (Reed 1959) as well as leaf hoppers, aphids, and small cicadas. Small, juvenile longnose dace feed primarily on algae and diatoms until they were large enough to consume the same diets as adults. Larger adults shifted their diet toward larger terrestrial insects as well as fish eggs from other Cyprinidae (Brazo, Liston, and Anderson, 1978).

Animal Foods: fish; eggs; insects; zooplankton

Plant Foods: algae; phytoplankton

Primary Diet: carnivore (Insectivore )

  • Beers, C., J. Culp. 1990. Plasticity in foraging behaviour of a lotic minnow (Rhinichthys cataractae) in response to different light intensities. Can. J. Zool, 68(1): 101–105.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Rhinichthys cataractae is a wide-ranging freshwater minnow that is an important part of the food chain in many stream habitats. One of the important functions these fish provide are consuming terrestrial insects, bringing them into the aquatic food chain. Longnose dace are a potential prey species to predatory stream fishes including many salmonid species. This is especially believed to occur when alewives (Alosa pseudoharengus) undergo substantial population crashes (Brazo, Liston, and Anderson, 1978).

Longnose dace are also hosts to 13 parasitic species, including individuals from 6 larger taxonomic groups: 1 monogenean fluke, 2 flukes, 2 cestode species, 4 nematodes, 1 spiny-headed worm, and 3 protozoan species) (Muzzall, Whelan, and Taylor, 1992).

Commensal/Parasitic Species:

  • Muzzall, P., G. Whelan, W. Taylor. 1992. Host-Parasite Relationships of Longnose Dace, Rhinichthys cataractae, from the Ford River, Michigan. The Journal of Parasitology, 78(5): 837-844.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Longnose dace are potential prey species for fish-eating birds, such as herons, and predatory stream fishes including many salmonid species (Brazo, Liston, and Anderson, 1978).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Rhinichthys cataractae (Long-nose Dace (N=2)) preys on:
Terrestrial invertebrates
Baetis
Conchapelopia
Dicrotendipes
Ectopria nervosa
Endochironomus
Eukiefferiella pseudomontana
Eukiefferiella dark type
Metriocnemus
Paranyctiophylax
Stempelinella
Cernotina
Eukiefferiella II
Eukiefferiella naonella type
Hydropyschidae
Paralauterborniella
Simulium
Stempellinella
Tanytarsini Genus A

Based on studies in:
USA: Maine, Martins (River)
USA: Maine, Troy (River)

This list may not be complete but is based on published studies.
  • Thompson, RM and Townsend CR. 2005. Energy availability, spatial heterogeneity and ecosystem size predict food-web structure in streams. OIKOS 108: 137-148.
  • Thompson, RM and Townsend, CR. 2003. Impacts on stream food webs of native and exotic forest: an intercontinental comparison. Ecology 84:145-161
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range averaged less than 14 m of stream length in North Carolina (Hill and Grossman 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Detailed information on Rhinichthys cataractae communication and perception is not available.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Study in southern Alberta found that foraging occurs at night (Culp 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Ovarian development probably of the group-synchronous type. Fecundity is determinate based on release of great majority of oocytes in a given spawning season, few signs of atretic oocytes and oocyte diameter distribution points to lack of substantial production of new oocytes (Ref. 51971).Spawn on rock and gravel. Larvae benthic (Ref. 7471). According to a study (Ref. 10280), although no nest is built, a territory is established and one parent guards the nest. In Manitoba, females lay 200-1200 transparent eggs hatching in 7-10 days at 15.6°C. Young are pelagic and inhabit quiet waters inshore; pelagic stage lasts 4 months before typical bottom dwelling existence of adults commence (Ref 1998). Spawn in riffles over gravelly bottom near nest of river chub.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

After fertilization, eggs develop for 3 to 4 days before hatching into protolarva. During this time, the head and tail separate from the yolk sac and the circulatory system begins to develop, as does the spinal cord. Pelagic protolarvae continue to develop, pigmentation begins, and early fin development occurs. By the 9th day after hatching, the sac is absorbed and the larvae are now considered mesolarvae. Fin rays become more defined and pigmentation continues to accumulate. As Rhinichthys cataractae metalarvae develop into juveniles, fin buds develop, the fish takes on the morphology of a juvenile (including an elongated fleshy snout), and pigmentation accumulation is completed (Fuiman and Loos, 1977; Cooper, 1980).

Juvenile longnose dace (Rhinichthys cataractae) continue to grow and develop in streams. Most longnose dace mature at age 2. A small percentage of adults are mature at age 1. This percentage increases slightly in lake-dwelling populations, where growth and maturation is accelerated (Brazo, Liston, and Anderson, 1978). Age 1 spawners are predominantly males, indicating possible shorter maturation times for males than females (Brazo, Liston, and Anderson, 1978). Mature individuals, both male and female, are approximately 75 mm in total length at the time of maturation (Roberts and Grossman, 2001). Females generally become the dominant sex and typically grow larger than males by age 3 (Gerald, 1966).

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Fuiman, L., J. Loos. 1977. Identifying Characters of the Early Development of the Daces Rhinichthys atratulus and R. cataractae. Proceedings of the Academy of Natural Sciences of Philadelphia, 129: 23-32.
  • Roberts, J., G. Grossman. 2001. Reproductive characteristics of female longnose dace in the Coweeta Creek drainage, North Carolina, USA. Ecology of Freshwater Fish, 10: 184-190.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Longnose dace have a maximum reported lifespan of 5 years, but lifespan is typically only 3 years for male individuals (Reed and Moulton, 1973; Brazo, Liston, and Anderson, 1978).

Range lifespan

Status: wild:
3 to 5 years.

Average lifespan

Status: wild:
3 years.

Typical lifespan

Status: wild:
2 to 3 for males, 4 to 5 for females years.

Average lifespan

Status: wild:
3 years.

  • Reed, R., J. Moultan. 1973. Age and growth of the blacknose dace, Rhinichthys atratulus and longnose dace, R. cataractae in Massachusetts.. American Midland Naturalist, (90)1: 206-210.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in spring and summer. Eggs hatch in about 7-10 days at 15.6 C. Sexually mature generally at age II (Becker 1983, Scott and Crossman 1973). Maximum lifespan 5 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult longnose dace are polygynandrous (promiscuous) because both mature males and females have multiple spawning partners. Males are territorial and breed with many females who visit their habitat (Bartnik, 1970). Female longnose dace are capable of spawning 6 or more times during their breeding season and will breed with multiple males during this time (Roberts and Grossman, 2001).

Mating System: polygynandrous (promiscuous)

Some longnose dace are capable of reproducing at age 1, all are mature by age 2 (Roberts and Grossman, 2001; Brazo, Liston, and Anderson, 1978). Mature individuals, both male and female, are approximately 75 mm in total length. While spawning typically occurs only in one year, females are capable of producing 6 or more clutches per year. Total potential fecundity ranged from 1155 to 2534 eggs for females in stream dwelling populations (Roberts and Grossman, 2001) and from 870 to 9,953 eggs per female in Lake Michigan populations (Brazo et al., 1978). Longnose dace larvae hatched 3 to 4 days after fertilization occurred; with an mean length of 5.9 mm (Fuiman and Loos, 1977; Cooper, 1980). Information on mass at the time of hatching was not available.  Spawning typically occurs in summer but timing is dependent on latitude and water temperature (Edwards, Li, and Schreck, 1983). Typical spawning season takes place in late June and early July (Brazo, Liston, and Anderson, 1978) but occurs as early as late May (Reed, 1959) and as late as August (McPhail and Lindsey 1970). Peak spawning typically occurs at water temperatures between 14° and 19° C (Brazo, Liston, and Anderson, 1978).

Breeding interval: Female longnose dace are capable of having 6 or more clutches per year but typically only spawn for 1 season.

Breeding season: Longnose dace reproduce between May and July.

Range number of offspring: 1155 to 2534.

Average number of offspring: 1832.

Range time to hatching: 3 to 4 days.

Range time to independence: 3 to 4 days.

Range age at sexual or reproductive maturity (female): 1 to 2 years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

In stream and lake-dwelling populations, spawning occurs over gravel. Male longnose dace construct a small nest in the pebbles where eggs are deposited (McPhail and Lindsey, 1970). Males are territorial and defend their spawning habitat, which is visited by multiple females (Brazo, Liston, and Anderson, 1978). After spawning, little or no parental care is given the eggs. They are are categorized as benthic spawners who broadcast their eggs over gravel. The eggs are not hidden (Helfman, Collette, and Facey, 1997). Embryos temporarily adhere to the gravel for 7 to 10 days and then the hatched fry become pelagic (McPhail and Lindsey, 1970; Cooper, 1980).

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Male)

  • Bartnik, V. 1970. Reproductive isolation between two sympatric dace, Rhinichthysa tratulus and R. cataractae, in Manitoba. J. Fish Res. Board Can., 27: 2125-2141.
  • Brazo, D., C. Liston, R. Anderson. 1978. Life History of the Longnose Dace, Rhinichthys cataractae, in the Surge Zone of Eastern Lake Michigan Near Ludington, Michigan. Trans. Am. Fish. Soc., 107(4): 550-556.
  • Cooper, J. 1980. Egg, Larval and Juvenile Development of Longnose Dace, Rhinichthys cataractae, and River Chub Nocomis micropogon with Notes on Their Hybridization. Copeia, 3: 469-478.
  • Edwards, E., H. Li, C. Schreck. 1983. Habitat suitability index models: Longnose dace. U.S. Dept. Int., Fish Wildl. Serv., FWS/OBS-82/10: 13.
  • Fuiman, L., J. Loos. 1977. Identifying Characters of the Early Development of the Daces Rhinichthys atratulus and R. cataractae. Proceedings of the Academy of Natural Sciences of Philadelphia, 129: 23-32.
  • Helfman, G., B. Collette, D. Facey. 1997. The diversity of fishes. Malden, Massachusetts: Blackwell Science.
  • McPhail, J., C. Lindsey. 1970. Freshwater fishes of northwestern Canada and Alaska. Bull. Fish. Res. Board Can., 173: 1-373.
  • Reed, R. 1959. Age, growth, and food of the longnose dace, Rhinichthys cataractae, in northwestern Pennsylvania. Copeia, 1959: 160-162.
  • Roberts, J., G. Grossman. 2001. Reproductive characteristics of female longnose dace in the Coweeta Creek drainage, North Carolina, USA. Ecology of Freshwater Fish, 10: 184-190.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Rhinichthys cataractae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 53
Specimens with Barcodes: 88
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Rhinichthys cataractae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 39 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGGATAGTGGGAACCGCTTTAAGCCTCCTTATTCGAGCTGAACTAAGCCAACCCGGATCACTCTTGGGTGATGACCAAATTTATAATGTCATCGTCACCGCCCACGCCTTTGTTATAATTTTCTTTATAGTCATGCCAATTCTTATTGGCGGCTTCGGAAACTGGCTTGTACCCCTAATAATCGGTGCACCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTGCCCCCATCATTTCTACTATTGCTAGCTTCTTCTGGAGTTGAGGCTGGCGCTGGAACAGGGTGAACTGTATACCCCCCGCTCGCAGGCAACCTCGCCCACGCAGGAGCATCAGTAGACCTCACAATCTTCTCTCTACACCTAGCAGGTGTATCATCAATTTTAGGGGCAGTTAACTTTATTACCACAATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACGCCTCTCTTTGTGTGGGCCGTACTTGTGACCGCTGTTCTCCTACTCCTGTCACTGCCCGTCCTAGCTGCCGGAATTACAATACTTCTCACGGACCGTAATCTTAATACCACATTCTTCGACCCGGCAGGGGGAGGAGACCCAATCTTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Longnose dace (Rhinichthys cataractae) are not listed as a species of special concern, endangered, threatened, or regionally extirpated in any of the following conservation lists: IUCN Red List, CITES appendices, or the United States Endangered Species Act.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: See Lanteigne (1988) for discussion of extinction of subspecies smithi due to introgressive hybridization with subspecies cataractae (marsh created by Cave and Basin Hotsprings, 1.7 km SW Banff, Alberta, Canada); initial decline of smithi is attributed to introductions of non-native fishes, periodic cessation of spring flow related to public use of hot springs, and periodic spillage of sewage from the public facilities (Miller et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats

Localized threats may exist, but on a range-wide scale no major threats are known.

See Lanteigne (1988) for discussion of extinction of subspecies smithi due to introgressive hybridization with subspecies cataractae (marsh created by Cave and Basin Hotsprings, 1.7 km SW Banff, Alberta, Canada); initial decline of smithi is attributed to introductions of non-native fishes, periodic cessation of spring flow related to public use of hot springs, and periodic spillage of sewage from the public facilities (Miller et al. 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquaculture: commercial; aquarium: commercial; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known negative affects of Rhinichthys cataractae on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Direct anthropogenic interactions are minimal with longnose dace, but in some areas they are used as bait for fishing (Scott and Crossman, 1998).

Positive Impacts: research and education

  • Scott, W., E. Crossman. 1998. Freshwater Fishes of Canada. Oakville, Ontario: Galt House Publications Ltd..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nooksack dace

The Nooksack dace is a small cyprinid fish occurring in streams in southern British Columbia and western Washington state. It has not yet been formally described taxonomically. It is considered a genetically distinct subspecies of longnose dace (Rhinichthys cataractae), but may be a distinct species. Its distribution in Canada is limited to four locations: three in the Nooksack basin, and one in the Fraser basin. This narrow distribution in habitats undergoing degradation due to urbanization, agriculture and other cases has led to the fish being declared endangered under Canada's Species at Risk Act. However, the Nooksack dace is much more widely distributed in Washington, occurring in eastern Puget Sound drainages from the Nooksack south to the Puyallup, and in Pacific coastal drainages from the Quillayute south to the Willapa.

References[edit]

  • Wydoski, Richard S.; Whitney, Richard R. (2003). Inland Fishes of Washington (2nd ed.). University of Washington Press. ISBN 978-0-295-98338-7. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Longnose dace

The longnose dace (Rhinichthys cataractae) is a freshwater minnow native to North America. Rhinicthys means snout fish (reference to the long snout) and catarace means of the cataract (first taken from Niagara Falls). Longnose dace are small, typically less than 100 mm and characterized by their fleshy snout that protrudes past the mouth. They are well adapted for living on the bottom of fast-flowing streams among stones. Longnose dace eat algae and aquatic insects and are important forage minnows for larger predatory fish.

Description[edit]

Longnose dace can be mistaken for suckers because of their subterminal "sucker-like" mouth. However, longnose dace (like all members of the cyprinidae family) lack small fleshy projections, called papillae, on their mouths.

Juveniles have a black lateral line that extends from the beginning of the eye to the caudal fin that fades as the fish matures. The lateral line in juveniles is not present in all populations. In adults, the dorsal side is dark green to black, the lateral side is darkish to silvery with mottling often present, and the ventral side is pearly. Both adult males and females may have bright orange-reddish colouration at the base of pectoral, pelvic, and anal fins and on the upper lip. This colouration is typically associated with breeding males in the subspecies Rhinichthys catarace catarace,[1] but the validity of this subspecies has yet to be confirmed. Museum specimens of females also show intense orange-reddish colouration at the base of the fins and upper lip,[2] therefore colouration is not an accurate predictor of sex.

The maximum length of longnose dace is 170 mm, but they are usually less than 100 mm.

Geographic distribution[edit]

Longnose dace have the widest distribution of any cyprinid in North America, with a range reaching as far south as the Rocky Mountains in northern Mexico and as far north as the Mackenzie River near the Arctic Circle[3] and across the continent from the Pacific to Atlantic coast. Multiple refugia during the most recent glacial maximum may explain the broad geographic distribution of longnose dace. There were up to three possible glacial refuges during Pleistocene glaciations: the Pacific, the Mississippi and the Atlantic.[3] Longnose dace on the Quebec peninsula likely originated only from the Atlantic refuge, in contrast to other fish species on the peninsula that originated from multiple refugia.[4] Longnose dace in northwestern North America originated from a Pacific refuge.[5]

Ecology[edit]

The tiny dark spots on the body of the longnose dace help it to blend in with sand and gravel, camouflaging the fish from predators.

Longnose dace occur in moderately cool water streams, rivers and lakes[2] with temperatures up to 22 °C. Longnose dace are benthic and preferentially occupy rock and gravel substrate. During the day longnose dace hide under rocks. Longnose dace prefer shallow, fast-moving riffles in streams and rivers and the turbulent, near-shore region of lakes.[6]

Longnose dace are opportunistic foragers. Small longnose dace (≤ 50 mm) primarily consume algae and benthic invertebrates dace (> 50 mm) feed on fish scales, fish eggs, terrestrial insects, and aquatic benthic macroinvertebrates, although diet varies seasonally.[7][8] They are nocturnal feeders, possibly to avoid predation and/or salmonid competitors.[9]

Longnose dace have small home ranges and high site fidelity,[10] however there is evidence that a small proportion are able to disperse distances greater than 500 km.[11]

Life history[edit]

Longnose dace reach reproductive maturity at age two[7] and have a mean lifespan of three years. Males and females have a maximum age of four and five, respectively.[2]

Longnose dace typically spawn from May to August in water 14 to 19 °C[7] and some populations are multiple spawners.[12] Time of spawning is dependent on water temperature.[3] Longnose dace are polygynandrous and males create and defend territories to attract females to enter and spawn. Males form a depression in the rocky substrate and vibrate to attract a female. When a female is receptive, she enters the territory and pushes her snout into substrate in a similar manner as the male. Both male and female tremble over the depression and release eggs and milt.[1] Limited or no parental care is provided to young-of-the-year after hatching.

Anthropogenic disturbance[edit]

In southern Alberta longnose dace are exposed to organic, estrogen-like compounds.[13] Downstream of wastewater effluent from the city of Red Deer longnose dace are larger, increase in abundance, and have larger livers but males have reduced ability to produce testosterone.[14] Despite a morphologically healthy appearance, longnose dace in the Red Deer River are physiologically stressed. In the Oldman River, some longnose dace populations are characterized by elevated vitellogenin expression, female biased sex ratios and intersex gonads.[15][16] Feminization is likely caused by estrogen-like compounds present in municipal wastewater effluent, agriculture, and cattle operations near the Oldman River, however this mechanism is not well understood. It is not known if increased vitellogenin expression and intersex gonads significantly decrease reproductive success and will impact the long term viability of longnose dace in these systems. There is not evidence of skewed sex ratios in the Bow River.[15]

References[edit]

  1. ^ a b Bartnik, V.G. 1971. "Comparison of the breeding habits of two subspecies of longnose dace, Rhinichthys catarace". Canadian Journal of Zoology 50: 83-86.
  2. ^ a b c Nelson, J.S. and M.J. Paetz. 1992. The Fishes of Alberta. The University of Alberta Press. Edmonton, Alberta.
  3. ^ a b c McPhail, J.D. and C.C. Lindsay. 1970. Freshwater Fishes of Northwestern Canada and Alaska. Freshwater Research Board of Canada. Ottawa, Ontario.
  4. ^ Girand, A. and B. Angers. “The impact of postglacial marine invasions on the genetic diversity of an obligate freshwater fish, the longnose dace (Rhinichthys catarace), on the Quebec peninsula”. Canadian Journal of Fisheries and Aquatic Sciences 63: 1429-1438.
  5. ^ McPhail, J.D. and E.B. Taylor. "Phylogeography of the longnose dace (Rhinichthys catarace) species group in northwestern North America – the origin and evolution of the Umpqua and Millicoma dace". Canadian Journal of Zoology 87: 491-497.
  6. ^ Edwards, E.A., H. Li and C.B. Schreck. 1983. “Habitat suitability index models: Longnose dace.” U.S. Department of the Interior, Fish and Wildlife Service. FWS/OBS-82/10.33 13 pp.
  7. ^ a b c Brazo, D.C., C.R. Liston and R.C. Anderson. 1978. "Life history of the Longnose dace, Rhinichthys catarace, in the surge zone of the eastern Lake Michigan near Ludington, Michigan". Transactions of the American Fisheries Society 107(4): 550-556.
  8. ^ Thompson, A.R., J.T. Petty and G.D. Grossman. 2001. "Multi-scale effect of resource patchiness on foraging behavior and habitat use by longnose dace, Rhinichthys catarace". Freshwater Biology 46: 145-160.
  9. ^ Culp, J.C. 1978. "Nocturnally constrained foraging of a lotic minnow (Rhinichthys catarace)". Canadian Journal of Zoology 67: 2008-2012.
  10. ^ Hill, J. and G.D. Grossman. 1987. "Home range estimates for three North American stream fishes". Copeia 1987(2): 376-380.
  11. ^ Larson, G.L., R.L. Hoffman, and S.E. Moore. 2002. "Observations of the distribution of five fish species in a small Appalachian stream". Transactions of the American Fisheries Society 131(4): 791-796.
  12. ^ Roberts, J.H. and G.D. Grossman. 2001. "Reproductive characteristics of female longnose dace in the Coweeta Creek drainage, North Carolina, USA". Ecology of Freshwater Fish 10: 184-190
  13. ^ Jeffries, K.M., L.J. Jackson, M.G. Ikonomou, and H.R. Habibi. 2010. "Presence of natural and anthropogenic organic contaminants and potential fish health impacts along two river gradients in Alberta, Canada." Environmental Toxicology and Chemistry 29(10): 2379-2010.
  14. ^ Jeffries, K.M., L.J. Jackson, L.E. Peters and K.R. Munkittrick. 2008. "Changes in population, growth, and physiological indices of longnose dace (Rhinichthys catarace) in the Red Deer River, Alberta, Canada." Archives of Environmental Contaminants and Toxicology 55: 639-65.
  15. ^ a b Jeffries, K.M., E.R. Nelson, L.J. Jackson and H.R. Habibi. "Basin-wide impacts of compounds with estrogen-like activity on longnose dace (Rhinichthys catarace) in two prairie rivers of Alberta, Canada." Environmental Toxicology and Chemistry 27(10): 2042-2052.
  16. ^ Evans, J.S., L.J. Jackson, H.R. Habibi, and M.G. Ikonomou. 2012. "Feminization of longnose dace (Rhinichthys catarace) in the Oldman River, Alberta, (Canada) provides evidence of widespread endocrine disruption in an agricultural basin." Scientifica 11 pages.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Three subspecies (cataractae, dulcis, and smithi) have been described; other populations probably deserve taxonomic recognition (Page and Burr 1991). Hybridizes with Rhinichthyes osculus, Gila pandora, and Campostoma anomalum (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!