Overview

Comprehensive Description

Biology

Inhabits shallow waters to depths of 90 m (Ref. 9626), especially over sand and rock bottoms in reef areas. Young juveniles often found on beds of seagrass, e.g. Thalassia. Feeds on small invertebrates (Ref. 9626). Flesh highly esteemed; marketed fresh and frozen (Ref. 3792). Traded as an aquarium fish at Ceará, Brazil (Ref. 49392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda and New Jersey, USA to Rio de Janeiro, Brazil; including the Gulf of Mexico and throughout the Caribbean Sea
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda and New Jersey, USA to Santa Catarina, Brazil (Ref. 57756), including the Gulf of Mexico and throughout the Caribbean Sea (Ref. 9626).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 89; Dorsal soft rays (total): 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A series of three large blackish blotches on upper side of body beneath dorsal fins; color variable but usually pale, the scales of the back with reddish or yellowish brown edges and a central pale blue spot; diagonal light blue lines on head. Capable of displaying a pattern of large red blotches on head and body in less than a minute (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 90 m (Ref. 9626), usually 0 - 35 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 114 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 1 - 80
  Temperature range (°C): 23.534 - 27.724
  Nitrate (umol/L): 0.174 - 1.979
  Salinity (PPS): 34.217 - 37.096
  Oxygen (ml/l): 3.991 - 4.873
  Phosphate (umol/l): 0.051 - 0.194
  Silicate (umol/l): 0.805 - 2.851

Graphical representation

Depth range (m): 1 - 80

Temperature range (°C): 23.534 - 27.724

Nitrate (umol/L): 0.174 - 1.979

Salinity (PPS): 34.217 - 37.096

Oxygen (ml/l): 3.991 - 4.873

Phosphate (umol/l): 0.051 - 0.194

Silicate (umol/l): 0.805 - 2.851
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 90m.
Recorded at 90 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits shallow waters to depths of 90 m (Ref. 9626), especially over sand and rock bottoms in reef areas. Young juveniles often found on beds of seagrass, e.g. Thalassia. Feeds on small invertebrates (Ref. 9626). Grubbers which excavate while moving, feed on bottom animals (Ref. 40396). Microinvertivore (Ref. 33499).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pseudupeneus maculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pseudupeneus maculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTCTTCGGTGCTTGGGCCGGTATGGTAGGAACTGCTTTAAGCCTTCTTATTCGTGCCGAGCTCAGCCAACCAGGCGCTCTTTTAGGAGACGACCAAATTTATAACGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATGGTAATGCCAATCATGATCGGCGGGTTCGGAAACTGACTCATCCCACTAATGATTGGTGCGCCAGATATGGCTTTCCCTCGAATGAACAATATGAGCTTTTGACTCCTTCCTCCATCTTTCCTCCTACTACTTGCCTCTTCAGGCGTTGAAGCAGGGGCAGGAACTGGTTGAACAGTATATCCCCCACTAGCCAGCAACTTAGCACACGCCGGTGCCTCAGTTGATTTAACCATCTTCTCGCTGCATCTGGCAGGTATCTCTTCTATTCTAGGAGCAATTAATTTCATTACCACAATTATTAATATGAAACCCCCTGCTATCTCGCAGTATCAAACCCCTCTATTTGTGTGGGCCGTACTAATCACAGCCGTCCTACTCCTGCTCTCACTCCCAGTTCTTGCCGCCGGCATTACAATGCTACTCACAGATCGTAATCTAAATACAACCTTCTTCGACCCAGCGGGAGGGGGAGATCCTATCCTTTACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!