Ecology

Associations

In Great Britain and/or Ireland:
Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Boletus subtomentosus is ectomycorrhizal with live root of Ectomycorrhizal broadleaved trees and shrubs

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Boletus subtomentosus is ectomycorrhizal with live root of Fagus sylvatica

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Boletus subtomentosus is ectomycorrhizal with live root of Pinopsida

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Xerocomus aff. subtomentosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCATTTTCTGTTCTTATTAGAATGGAATTAATGTCTCCAGGAGTACAAATATTATCAGGAGATCATCAATTATTTAATGTAATTATTAGTGCTCATGCTTTCATAATGATTTTCTTCATGGTTATGCCTGGTCTTGTAGGAGGATTTGGTAATTATTTATTACCTGTACAATGTGGGGCTCCTGATATGGCTTTCCCTAGATTAAATAATATTAGTTTCTGGTTATTACCTCCTTCATTAATTTTATTATTATTAAGTTCTTTAGTAGAACAAGGAGCAGGAACAGGATGGACAGTATATCCACCATTATCTTCTATTCAATCACATTCAGGAGGTAGTGTAGATTTAGCTATTTTTAGTTTACACTTAGCTGGGGTATCTTCATTATTAGGTGCAATAAACTTCATAACAACAGTATTAAATATGAGAACAAATGGAATGAGCTTACATAAATTACCATTATTTGTATGGGCTATTTTTGTAACTGCTATTTTATTATTATTATCTTTACCTGTGTTAGCTGGTGCTATTACTATGTTATTAACAGATAGAAACTTTAATACTAGTTTCTATGATC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xerocomus aff. subtomentosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Xerocomus subtomentosus

Xerocomus subtomentosus
View the Mycomorphbox template that generates the following list
Mycological characteristics
pores on hymenium
cap is convex
stipe is bare
spore print is olive-brown
edibility: edible

Xerocomus subtomentosus, commonly known as suede bolete, brown and yellow bolet, boring brown bolete or yellow-cracked bolete, is a species of edible mushroom in the family Boletaceae. It occurs in forests throughout Eurasia, North America and Australia and forms a mycorrhizal relationship with a wide range of hardwood and conifer trees.

Taxonomy[edit]

Xerocomus subtomentosus was first described in 1753 by the father of taxonomy Carl Linnaeus as Boletus subtomentosus. The starting date of fungal taxonomy had been set as January 1, 1821, to coincide with the date of the works of the 'father of mycology', Swedish naturalist Elias Magnus Fries, which meant that the name required sanction by Fries (indicated in the name by a colon) to be considered valid, as Linnaeus' work preceded this date. It was thus written Boletus subtomentosus L.:Fr. However, a 1987 revision of the International Code of Botanical Nomenclature set the starting date at May 1, 1753, the date of publication of Linnaeus' seminal work, the Species Plantarum.[1] Hence the name no longer requires the ratification of Fries' authority.

French mycologist Lucien Quélet had classified a number of Boletus species in the genus Xerocomus, with Xerocomus subtomentosus made the type species. The name is derived from the Ancient Greek Xeros "dry" and kome "hair", and refers to the velvety surface of the cap.[2] This classification was disputed with many authorities not recognising the genus, however genetic analysis published in 2013 confirms the distinctness of this species and its close relatives from Boletus sensu stricto. Xerocomus subtomentosus and relatives, including Phylloporus pelletieri form a clade known informally as the xerocomus clade within a larger group (informally called hypoboletus) in the suborder Boletineae. Other clades within the group include the Aureoboletus and Hemileccinum clades, as well as species currently designated Boletus (though they are not closely related to Boletus edulis) and three species currently designated Boletellus (though they are unlikely to be close relatives of the type species, Boletellus ananas). The clade containing the hypoboletus group and the Royoungia clade is sister to the anaxoboletus group (containing the genera Tylopilus sensu stricto, Strobilomyces, Xanthoconium, Porphyrellus, Xerocomellus, Boletus sensu stricto, and species that require new generic names (e.g., Boletus badius) and the leccinoid group (comprising the genera Leccinellum, Leccinum, Spongiforma, and the species Retiboletus griseus). [3] As it (X. subtomentosus) is the type of the genus, it and close relatives remain Xerocomus as other members are placed in different genera.

Its specific name subtomentosus is Latin "finely haired", referring to its cap.[2] Mushroom author David Arora nicknamed the mushroom the boring brown bolete from its lack of taste and appeal.[4] Other vernacular names include "yellow-cracked bolete", "suede bolete",[5] and "brown and yellow bolete".[6]

Description[edit]

The pale olive or tan cap is initially convex before flattening, and measures 4 to 10 cm (1.6 to 3.9 in) or sometimes up to 18 cm (7.1 in) in diameter with a velvety tan surface. Occasionally the cap slits revealing yellow flesh beneath. The skin of the cap is very hard to remove. The pores underneath the cap are yellow, and bruise blue or green before fading somewhat. The stipe lacks a ring and is up to 8 cm (3.1 in) tall by 1–2 cm (0.4–0.8 in) wide. The spore print is olive-brown. A drop of ammonium hydroxide on the cap instantly produces a mahogany red reaction, which distinguishes it from some other similar species of the genus. The flesh is white and has little taste or smell.[2][4]

Similar species[edit]

The rare European species Xerocomus silwoodensis, described as new to science in 2007, is similar in appearance to X. subtomentosus. It can be distinguished from the latter in the field by the darker reddish-brown tones of the cap and its preference for associating with Populus trees.[7]

Distribution and habitat[edit]

Xerocomus subtomentosus occurs in autumn in forests throughout Eurasia, North America and Australia and forming a mycorrhizal relationship with a wide range of hardwood and conifer trees.[4][2] It is associated with bilberry and other evergreen shrubs of the Ericaceae.[5][6]

Edibility[edit]

Xerocomus subtomentosus is edible, although not highly regarded. Its mild taste makes it suitable for mixed mushroom dishes.[2] An elemental analysis of specimens collected from Notec Forest in western Poland determined the mushrooms to have abundant amounts of potassium, phosphorus, and magnesium, with mean values of 46000, 8400, and 1100 milligramme/kilogramme dry weight, respectively, in the caps. The levels of the toxic metals cadmium, mercury, and lead in the mushrooms "did not pose a threat to a consumer's health".[8]

See also[edit]

References[edit]

  1. ^ Esser, K.; Lemke, P.A. (1994). The Mycota: A Comprehensive Treatise on Fungi as Experimental Systems for Basic and Applied Research. Heidelberg, Germany: Springer. p. 81. ISBN 3-540-66493-9. 
  2. ^ a b c d e Nilson, S.; Persson, O. (1977). Fungi of Northern Europe 1: Larger Fungi (Excluding Gill-Fungi). Penguin. p. 106. ISBN 0-14-063005-8. 
  3. ^ Nuhn, M.E.; Binder, M.; Taylor, A.F.S.; Halling, R.E.; Hibbett, D.S. (2013). "Phylogenetic overview of the Boletineae". Fungal Biology 117 (7–8): 479–511. doi:10.1016/j.funbio.2013.04.008. PMID 23931115. 
  4. ^ a b c Arora, D. (1986). Mushrooms Demystified: A Comprehensive Guide to the Fleshy Fungi (2nd ed.). Berkeley, California: Ten Speed Press. pp. 517–18. ISBN 0-89815-169-4. 
  5. ^ a b Michell, Kate (2006). Field Guide to Mushrooms and Other Fungi of Britain and Europe. New Holland Publishers. p. 34. ISBN 1-84537-474-6. 
  6. ^ a b Laursen, Gary A.; Seppelt, Rodney D. (2010). Common Interior Alaska Cryptogams: Fungi, Lichenicolous Fungi, Lichenized Fungi, Slime Molds, Mosses, and Liverworts. University of Alaska Press. p. 75. ISBN 978-1-60223-109-2. 
  7. ^ Taylor, A.F.S.; Hills, A.E.; Simonini, G.; Muñoz, J.A.; Eberhardt, U. (2007). "Xerocomus silwoodensis sp. nov., a new species within the European X. subtomentosus complex". Mycological Research 111 (4): 403–08. doi:10.1016/j.mycres.2007.01.014. PMID 17512181. 
  8. ^ Jarzynska, Grazyna; Chojnacka, Aleksandra; Dryzalowska, Anna; Nnorom, Innocent C.; Falandysz, Jerzy (2012). "Concentrations and bioconcentration factors of minerals in yellow-cracking bolete (Xerocomus subtomentosus) mushroom collected in Notec Forest, Poland". Journal of Food Science 77 (9): H202–H206. doi:10.1111/j.1750-3841.2012.02876.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!