Overview

Comprehensive Description

Biology

Adults inhabit deeper waters over sandy or rocky bottoms and near drop-offs and ledges. Young occur in shallower water, often between about 35 and 50 m. Feed mainly on fishes. Good food fish, it is marketed mostly fresh (Ref. 55).
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lutjanus bucanella :

MZUSP 65240 (1, 232), Tamandaré ( 8°49’S , 35°5’W ), Pernambuco State , Brazil .

  • Rodrigo L. Moura, Kenyon C. Lindeman (2007): A new species of snapper (Perciformes: Lutjanidae) from Brazil, with comments on the distribution of Lutjanus griseus and L. apodus. Zootaxa 1422, 31-43: 32-32, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:EDE9214C-AABF-4706-AA56-C303C37A6B3C
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description: Body wide and relatively thick with a sloping forehead and a large round eye (distinctly larger than in the shallow-water congeners) and large terminal mouth. Dorsal-fin base long and anal-fin base short. Prominent dorsal, anal, and pelvic-fin spines and a large non-serrated preopercular spine.

Transitional stage: Transitional recruits show only a speckling of fine surface melanophores in addition to the residual larval melanophore complement. The lateral spot is made up of fine melanophores in a wide ellipse centered on the lateral line under the soft dorsal fin. The body becomes covered in fine leukophores. Lateral and ventral iridescence is prominent and includes a stripe from the mid-upper jaw around the lower eye socket and then widening to cover the preopercle. In life, a distinctive yellow saddle-patch develops on the dorsal caudal peduncle.

Juveniles: Juvenile L. buccanella

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: as far north as North Carolina, USA and Bermuda south to Trinidad and northern Brazil; including the Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: as far north as North Carolina, USA and Bermuda south to Trinidad and northern Brazil; including the Gulf of Mexico (Ref. 9626). Very common in the Caribbean, particularly the Antilles.
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 14; Analspines: 3; Analsoft rays: 8
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 750 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

75.0 cm TL (male/unsexed; (Ref. 9710)); max. published weight: 14.0 kg (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Modal fin-ray counts of D-X,14 A-III,8 are shared among most of the regional Lutjanus species, including L. analis, L. apodus, L. cyanopterus, L. griseus, L. jocu and the deep-water snappers L. buccanella, L. campechanus, and L. vivanus. L. buccanella juveniles have a distinctive yellow saddle mark on the upper caudal peduncle and an indistinct lateral spot. (DNA)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preopercular notch and knob weak. Scale rows on back rising obliquely above lateral line. Mainly scarlet red, silvery on lower sides and belly; fins are yellowish to orange. A prominent black blotch is at the base and in axil of pectoral fins.
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

MZUSP 65240 (1, 232), Tamandaré ( 8°49’S , 35°5’W ), Pernambuco State , Brazil .

License not applicable

Rodrigo L. Moura

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 20 - 200 m (Ref. 9626), usually 80 - 150 m (Ref. 55)
  • Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0.4 - 53
  Temperature range (°C): 23.720 - 26.404
  Nitrate (umol/L): 0.501 - 1.112
  Salinity (PPS): 36.080 - 36.291
  Oxygen (ml/l): 4.437 - 4.807
  Phosphate (umol/l): 0.094 - 0.118
  Silicate (umol/l): 0.805 - 4.752

Graphical representation

Depth range (m): 0.4 - 53

Temperature range (°C): 23.720 - 26.404

Nitrate (umol/L): 0.501 - 1.112

Salinity (PPS): 36.080 - 36.291

Oxygen (ml/l): 4.437 - 4.807

Phosphate (umol/l): 0.094 - 0.118

Silicate (umol/l): 0.805 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 20 - 200m.
From 20 to 200 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus buccanella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCGCATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGATTCGGGAACTGACTAATCCCATTAATAATCGGAGCCCCCGATATGGCATTCCCTCGGATAAATAACATGAGCTTTTGACTTCTCCCACCATCATTCCTACTGCTCCTCGCCTCTTCTGGAGTAGAAGCCGGGGCTGGGACTGGATGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCACACGCAGGAGCATCTGTAGACTTAACTATTTTCTCCCTGCATCTAGCAGGTGTTTCCTCAATTCTAGGGGCCATCAACTTCATTACAACAATTATCAATATGAAACCCCCTGCCATCTCCCAATATCAGACACCGCTATTCGTTTGAGCCGTCCTAATTACTGCTGTCCTACTTCTTCTCTCTCTGCCAGTTCTAGCGGCCGGAATTACAATACTTCTTACGGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGGGACCCCATCCTCTACCAACACCTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus buccanella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blackfin snapper

The blackfin snapper, Lutjanus buccanella, is a species of snapper native to the western Atlantic Ocean including the Gulf of Mexico and the Caribbean Sea. It is a commercially important species, though it has been reported to carry the ciguatera toxin.[1]

Description[edit]

Its color is typically a scarlet red with silvery undersides. It has a black crescent-shaped mark at the base of its pectoral fins. The fins are yellow to orange. This species can reach a length of 75 cm (30 in), though most do not exceed 50 cm (20 in). The greatest known weight for this species is 14 kg (31 lb).[1]

Distribution[edit]

The blackfin snapper is found from North Carolina and Bermuda south to northern Brazil. It occurs most commonly in the Caribbean, being especially common around the Antilles.[1]

Habitat and habits[edit]

This species inhabits areas near reefs at depths of from 20 to 200 m (66 to 656 ft) (usually between 80 and 150 m (260 and 490 ft)). Juveniles tend to be found in shallower waters than adults, which tend to inhabit deeper water near drop-offs with sandy or rocky bottoms. Like other snapper, it is predatory and feeds primarily on smaller fish.[1]

References[edit]

  1. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2013). "Lutjanus buccanella" in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!