Overview

Comprehensive Description

Lutjanus bucanella :

MZUSP 65240 (1, 232), Tamandaré ( 8°49’S , 35°5’W ), Pernambuco State , Brazil .

  • Rodrigo L. Moura, Kenyon C. Lindeman (2007): A new species of snapper (Perciformes: Lutjanidae) from Brazil, with comments on the distribution of Lutjanus griseus and L. apodus. Zootaxa 1422, 31-43: 32-32, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:EDE9214C-AABF-4706-AA56-C303C37A6B3C
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description: Body wide and relatively thick with a sloping forehead and a large round eye (distinctly larger than in the shallow-water congeners) and large terminal mouth. Dorsal-fin base long and anal-fin base short. Prominent dorsal, anal, and pelvic-fin spines and a large non-serrated preopercular spine.

Transitional stage: Transitional recruits show only a speckling of fine surface melanophores in addition to the residual larval melanophore complement. The lateral spot is made up of fine melanophores in a wide ellipse centered on the lateral line under the soft dorsal fin. The body becomes covered in fine leukophores. Lateral and ventral iridescence is prominent and includes a stripe from the mid-upper jaw around the lower eye socket and then widening to cover the preopercle. In life, a distinctive yellow saddle-patch develops on the dorsal caudal peduncle.

Juveniles: Juvenile L. buccanella

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults inhabit deeper waters over sandy or rocky bottoms and near drop-offs and ledges. Young occur in shallower water, often between about 35 and 50 m. Feeds mainly on fishes. Good food fish, it is marketed mostly fresh (Ref. 55).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: as far north as North Carolina, USA and Bermuda south to Trinidad and northern Brazil; including the Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: as far north as North Carolina, USA and Bermuda south to Trinidad and northern Brazil; including the Gulf of Mexico (Ref. 9626). Very common in the Caribbean, particularly the Antilles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 14; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 750 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

75.0 cm TL (male/unsexed; (Ref. 9710)); max. published weight: 14.0 kg (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Modal fin-ray counts of D-X,14 A-III,8 are shared among most of the regional Lutjanus species, including L. analis, L. apodus, L. cyanopterus, L. griseus, L. jocu and the deep-water snappers L. buccanella, L. campechanus, and L. vivanus. L. buccanella juveniles have a distinctive yellow saddle mark on the upper caudal peduncle and an indistinct lateral spot. (DNA)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preopercular notch and knob weak. Scale rows on back rising obliquely above lateral line. Mainly scarlet red, silvery on lower sides and belly; fins are yellowish to orange. A prominent black blotch is at the base and in axil of pectoral fins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

MZUSP 65240 (1, 232), Tamandaré ( 8°49’S , 35°5’W ), Pernambuco State , Brazil .

License not applicable

Rodrigo L. Moura

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 20 - 200 m (Ref. 9626), usually 80 - 150 m (Ref. 55)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0.4 - 53
  Temperature range (°C): 23.720 - 26.404
  Nitrate (umol/L): 0.501 - 1.112
  Salinity (PPS): 36.080 - 36.291
  Oxygen (ml/l): 4.437 - 4.807
  Phosphate (umol/l): 0.094 - 0.118
  Silicate (umol/l): 0.805 - 4.752

Graphical representation

Depth range (m): 0.4 - 53

Temperature range (°C): 23.720 - 26.404

Nitrate (umol/L): 0.501 - 1.112

Salinity (PPS): 36.080 - 36.291

Oxygen (ml/l): 4.437 - 4.807

Phosphate (umol/l): 0.094 - 0.118

Silicate (umol/l): 0.805 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 20 - 200m.
From 20 to 200 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lutjanus buccanella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lutjanus buccanella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCGCATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGATTCGGGAACTGACTAATCCCATTAATAATCGGAGCCCCCGATATGGCATTCCCTCGGATAAATAACATGAGCTTTTGACTTCTCCCACCATCATTCCTACTGCTCCTCGCCTCTTCTGGAGTAGAAGCCGGGGCTGGGACTGGATGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCACACGCAGGAGCATCTGTAGACTTAACTATTTTCTCCCTGCATCTAGCAGGTGTTTCCTCAATTCTAGGGGCCATCAACTTCATTACAACAATTATCAATATGAAACCCCCTGCCATCTCCCAATATCAGACACCGCTATTCGTTTGAGCCGTCCTAATTACTGCTGTCCTACTTCTTCTCTCTCTGCCAGTTCTAGCGGCCGGAATTACAATACTTCTTACGGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGGGACCCCATCCTCTACCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blackfin snapper

The blackfin snapper, Lutjanus buccanella, is a species of snapper native to the western Atlantic Ocean including the Gulf of Mexico and the Caribbean Sea. It is a commercially important species, though it has been reported to carry the ciguatera toxin.[1]

Description[edit]

Its color is typically a scarlet red with silvery undersides. It has a black crescent-shaped mark at the base of its pectoral fins. The fins are yellow to orange. This species can reach a length of 75 cm (30 in), though most do not exceed 50 cm (20 in). The greatest known weight for this species is 14 kg (31 lb).[1]

Distribution[edit]

The blackfin snapper is found from North Carolina and Bermuda south to northern Brazil. It occurs most commonly in the Caribbean, being especially common around the Antilles.[1]

Habitat and habits[edit]

This species inhabits areas near reefs at depths of from 20 to 200 m (66 to 656 ft) (usually between 80 and 150 m (260 and 490 ft)). Juveniles tend to be found in shallower waters than adults, which tend to inhabit deeper water near drop-offs with sandy or rocky bottoms. Like other snapper, it is predatory and feeds primarily on smaller fish.[1]

References[edit]

  1. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2013). "Lutjanus buccanella" in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!