Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: frogfish (English), pejerana (Espanol), ranisapo (Espanol), zanahoria (Espanol)
 
Antennarius commerson (Latreille, 1804)

Commerson's frogfish


Body globular, somewhat compressed;  a very large, upward directed mouth;  fishing pole ~ twice as long as second dorsal spine, lure (length ~ 20% of pole length), elongate, with a cluster of small filaments at the base; second dorsal spine joined to head by thick, fleshy membrane; 3rd  dorsal spine curved to rear, movable, not bound down by skin; limb-like pectoral fins with an "elbow" joint,  that fin broadly connected to body; a small round gill opening, below and behind pectoral base; with a tail base; pelvic fins short; skin of body rough, covered with close-set, double-pointed spicules.



Pink, red, brown, yellow, green; body and fins spotted or mottled with blotches of lighter or darker colors - purple, brown, black, white; 0-15 short dark bars radiating from eye.

Size: 35 cm.

Habitat: rocky bottoms.

Depth: 5-70 m, usually deeper than 20 m.

Indo-Pacific; central Mexico to Colombia, the Revillagigedos,  Cocos, Malpelo and Gorgona Island (Colombia).   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found in lagoon and seaward reefs (Ref. 9710), often on jetty Pylons (Ref. 48635). Benthic (Ref. 58302). Feed on fish (Ref. 11889). Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific and Eastern Pacific: Red Sea and South Africa (Ref. 4113) to Panama, north to southern Japan and the Hawaiian Islands, south to the Lord Howe and the Society islands. Referred to as Antennarius moluccensis by authors.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 5 (S) - 70 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 12 - 13; Analspines: 0; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 35.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 330 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

38.0 cm TL (male/unsexed; (Ref. 54980))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Comes in a variety of colors: yellow, orange, green, brown, and black. Bony part of illicium about equal to length of the 2nd dorsal spine (10.2-16.9 %SL); esca a small tuft of flattened appendages (Ref. 4538). Illicial length in %SL: 19.3-25.2 (Ref. 6773). Membrane behind 2nd dorsal spine thick and spinulose, extending to base of third (Ref. 6773). One of the largest species (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 70 m (Ref. 37816), usually ? - 20 m (Ref. 9269)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 22 - 70
  Temperature range (°C): 24.049 - 28.582
  Nitrate (umol/L): 0.189 - 0.241
  Salinity (PPS): 35.035 - 35.503
  Oxygen (ml/l): 4.549 - 4.855
  Phosphate (umol/l): 0.133 - 0.218
  Silicate (umol/l): 1.305 - 1.311

Graphical representation

Depth range (m): 22 - 70

Temperature range (°C): 24.049 - 28.582

Nitrate (umol/L): 0.189 - 0.241

Salinity (PPS): 35.035 - 35.503

Oxygen (ml/l): 4.549 - 4.855

Phosphate (umol/l): 0.133 - 0.218

Silicate (umol/l): 1.305 - 1.311
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 45m.
Recorded at 45 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antennarius commerson

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTGTATCTTGTATTTGGAGCATGGGCCGGCATAGTAGGAACAGCTCTCAGCCTGCTAATCCGGGCAGAATTAAGTCAACCAGGCGCACTACTAGGTGACGATCAAATTTATAATGTAATCGTCACAGCACACGCTTTCGTCATAATTTTCTTTATAGTTATGCCTATCATGATCGGAGGGTTTGGTAATTGACTAATCCCACTAATAATTGGCGCTCCAGACATGGCATTCCCACGAATAAATAATATAAGCTTCTGACTCTTACCCCCATCCTTCCTTCTTTTATTAGCATCTTCAATAGTAGAAGCCGGGGCAGGAACAGGATGAACAGTGTACCCCCCTCTTGCTGGCAACCTAGCCCACGCAGGGGCATCAGTTGATTTAACTATCTTCTCACTCCATCTTGCAGGTGTTTCATCTATCCTAGGGGCTATCAATTTTATTACCACTATTATTAATATAAAACCCCCAGCCCTTTCACAGTATCAAACACCATTATTTGTCTGAGCTGTATTAGTCACTGCTGTGCTCCTTCTTCTCTCCCTTCCTGTTCTTGCTGCCGGAATCACAATATTACTCACTGACCGAAACCTTAACACAACTTTCTTTGACCCTACCGGAGGAGGAGACCCTATTCTCTATCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antennarius commerson

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Commerson's frogfish

The Commerson's frogfish changes its colour through a range of hues, and uses its pelvic fins to walk on the bottom and keep a stable position for ambush

Commerson's frogfish or the giant frogfish, Antennarius commerson, is a marine fish belonging to the family Antennariidae.

Description[edit]

Commerson's frogfish grows up to 38 cm (15 in). Like other members of its family, it has a globular, extensible body. The soft skin is covered with small dermal spinules. Its skin is partially covered with a few small, wartlike protuberances, some variably shaped, scab-like blotches, and a few, small eye spots (ocelli) reminiscent of the holes in sponges. Its large mouth is prognathous, allowing it to consume prey as large as itself. Their coloration is extremely variable, as they tend to match their environments. Frogfish can change their coloration in a few weeks. However, the dominant coloration goes from grey to black, passing through a whole range of related hues, such as cream, pink, yellow, red, and brown, and also usually with circular eye spots or blotches that are darker than the background. Juvenile specimens can easily be confused with related Antennarius maculatus and Antennarius pictus. To distinguish these species, A. maculatus usually has red or orange margins on all fins, while A. maculatus has numerous warts on the skin, and A. pictus is covered with ocelli. A. pictus has three eye spots on its caudal fin.[1]

The first dorsal spine, the illicium, is modified for use as a fishing rod. Its extremity is endowed with a characteristic esca (lure), which resembles a small fish or shrimp with a pinkish to brownish coloration. The illicium is twice the length of the second dorsal spine and is often darkly banded. The second dorsal spine is practically straight and is mobile, the third one is bent towards the back of the body, and both are membranously attached to the head. They are well separated from each other and also from the dorsal fin.[2]

The pectoral fins are angled, and the pelvic fins help the frogfish move on the bottom and keep a stable position for ambush.

Distribution and habitat[edit]

Antennarius commerson lives in the tropical and subtropical waters from the Indian Ocean to the eastern coasts of the Pacific Ocean.[3] It is found in lagoons and sheltered rocky and coral reefs. They are usually associated with big sponges, on underwater ropes, on jetty pillars, or any structures down to 70 m (230 ft) deep, with an average occurrence at 20 m (66 ft) deep.[4]

Feeding and behavior[edit]

As all frogfishes, A. hispidus is a voracious carnivore which attacks any small animals that pass within range, mainly other fish, but sometimes even congeners.[2] Commerson's frogfish has a benthic and solitary lifestyle. They gather during the mating period, but do not tolerate each other any more after the act of fertilization. The male can kill or eat the female if she stays close.[2]

References[edit]

  1. ^ EOL: Frogfishes
  2. ^ a b c Pietsch & Grobecker, Frogfishes of the world, Stanford University Press, 1987, ISBN 9780804712637
  3. ^ EOL: Frogfish: distribution
  4. ^ EOL: Frogfish: habitat
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!