Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Sargocentron rubrum ( Forsskål , 1775)

Mediterranean Sea : 9200-453 (1 spc.), August 1968 , M. Demir .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 41-41, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found in coastal reefs (Ref. 9710); silty reefs or wrecks in lagoons, bays, or harbors (Ref. 27370), may occur in aggregations; also found hidden in caves and cracks of rocks during the day (Ref. 12382, 48635), usually in areas subject to strong currents (Ref. 48635). Feed mainly on benthic crabs and shrimps (Ref. 2334), also preys on small fishes (Ref. 12382). Eggs and larvae are pelagic (Ref. 6746). Spine of preopercle venomous (Ref. 2334).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea to the western Pacific where it ranges from southern Japan to New Caledonia and New South Wales, Australia. Recently recorded from Tonga (Ref. 53797). Not yet recorded from any oceanic island in the western Indian Ocean. Invaded eastern Mediterranean via the Suez Canal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa to Tonga, north to southern Japan, south to Western Australia, New South Wales (Australia), New Caledonia and Lord Howe Island; southeastern Atlantic; Mediterranean Sea immigrant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 14; Analspines: 4; Analsoft rays: 8 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 320 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

32.0 cm TL (male/unsexed; (Ref. 5213))
  • Fischer, W., I. Sousa, C. Silva, A. de Freitas, J.M. Poutiers, W. Schneider, T.C. Borges, J.P. Feral and A. Massinga 1990 Fichas FAO de identificaçao de espécies para actividades de pesca. Guia de campo das espécies comerciais marinhas e de águas salobras de Moçambique. Publicaçao preparada em collaboraçao com o Instituto de Investigaçao Pesquiera de Moçambique, com financiamento do Projecto PNUD/FAO MOZ/86/030 e de NORAD. Roma, FAO. 1990. 424 p. (Ref. 5213)   http://www.fishbase.org/references/FBRefSummary.php?id=5213&speccode=151 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits protected habitats (Ref. 5213). Feeds mainly on benthic crabs and shrimps at night. Spine of preopercle venomous.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body with subequal stripes of brownish red and silvery white; spinous dorsal dark red with a large, quadrangular, whitish blotch in middle of each membrane (except the first) forming a median band; dorsal membrane tips white, except posteriorly (Ref. 4201). Five oblique scale rows on cheek; body depth 2.5-2.8 in SL; head length (HL) 2.65-2.85 in SL; short and blunt snout, its length 4.25-4.7 in HL; interorbital width 4.5 in HL; mouth terminal to slightly inferior, maxilla usually extending nearly to or a short distance beyond a vertical through center of eye, upper jaw length 2.5-2.75 in HL; premaxillary groove often ending above anterior edge of orbit; anterior end of nasal bone with a blunt spine; surface or medial edge of nasal bone spineless; nasal fossa usually without spinules on its edge; upper edge of 1st suborbital bone with a slightly retrorse lateral spine a short distance posterior to a vertical at front edge of eye, followed by a ridge of recumbent spinules; preopercular spine usually about 2/3 orbit diameter, 3.2-5.3 in HL; 3rd-5th dorsal spines subequal, longest in adults 1.9-2.3 in HL; 3rd anal spine 1.35-1.6 in HL (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 84 m (Ref. 27370)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 306 specimens in 1 taxon.
Water temperature and chemistry ranges based on 214 samples.

Environmental ranges
  Depth range (m): 0.5 - 180
  Temperature range (°C): 15.629 - 29.264
  Nitrate (umol/L): 0.075 - 12.830
  Salinity (PPS): 32.019 - 38.944
  Oxygen (ml/l): 2.079 - 4.955
  Phosphate (umol/l): 0.070 - 1.170
  Silicate (umol/l): 0.974 - 19.050

Graphical representation

Depth range (m): 0.5 - 180

Temperature range (°C): 15.629 - 29.264

Nitrate (umol/L): 0.075 - 12.830

Salinity (PPS): 32.019 - 38.944

Oxygen (ml/l): 2.079 - 4.955

Phosphate (umol/l): 0.070 - 1.170

Silicate (umol/l): 0.974 - 19.050
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 84m.
From 1 to 84 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits rocky reefs and coral reefs (Ref. 9137, 9710, 58534, 58652); silty reefs or wrecks in lagoons, bays, or harbors (Ref. 27370), may occur in aggregations; also found hidden in caves and cracks of rocks during the day (Ref. 12382, 48635). Usually in areas subject to strong currents (Ref. 48635). Feeds mainly on benthic crabs and shrimps (Ref. 2334), also preys on small fishes (Ref. 12382). Spine of preopercle venomous (Ref. 2334).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sargocentron rubrum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCAACCAACCACAAAGACATTGGTACCCTCTATTTAGTATTTGGTGCCTGAGCTGGAATAGTTGGAACGGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGTCAACCCGGAGCCCTTCTGGGGGAC---GATCAAATTTATAATGTCATTGTTACAGCGCACGCGTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCCCTGATAATCGGAGCTCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTTCTACCTCCCTCATTCCTTCTTCTGCTAGCTTCTTCAGGAGTAGAAGCCGGTGCCGGAACAGGGTGAACAGTTTACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGATCTTACTATTTTCTCACTCCATTTAGCTGGTATTTCCTCAATCCTAGGGGCCATTAATTTCATTACAACTATCATTAATATGAAACCCCCTGCCATCTCCCAATATCAGACCCCTCTTTTCGTATGGGCTGTCCTAATTACAGCTGTCCTTCTTCTCCTGTCCCTACCTGTACTTGCAGCAGGTATTACTATGCTGCTAACAGACCGAAATCTAAACACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCTATTCTATATCAACACCTGTTTTGATTCTTTGGTCACCCTGAAGTATATATTCTTATCCTACCCGGATTTGGAATGATTTCCCACATTGTCGCCTACTATTCCGGAAAAAAAGAACCTTTCGGTTACATAGGAATGGTTTGAGCTATGATAGCAATCGGCCTTCTAGGGTTTATTGTTTGAGCCCATCACATGTTCACAGTTGGAATGGACGTTGACACACGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron rubrum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sargocentron rubrum

Sargocentron rubrum, also known as redcoat, is a member of the family Holocentridae of the order Beryciformes. Squirrelfish in general are large, active, nocturnal fish which are usually red in color.[2]

It is found in the Indian Ocean, from the Red Sea to the West Pacific, where it ranges from southern Japan to New Caledonia and New South Wales, Australia. Recently recorded also in Tonga. It invaded the eastern Mediterranean via the Suez Canal.[3]

References[edit]

  1. ^ Sargocentron rubrum - The Taxonomicon
  2. ^ The Ultimate Encyclopedia of Aquarium Fish & Fish Care, by Mary Bailey & Gena Sandford, page 246
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Sargocentron rubrum" in FishBase. July 2006 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!