Overview

Distribution

Central America: Laguna de Catemaco in Veracruz, Mexico.
  • Wischnath, L. 1993 Atlas of livebearers of the world. T.F.H. Publications, Inc., United States of America. 336 p. (Ref. 26130)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lago de Catemaco, Atlantic Slope of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 40 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

4.0 cm TL (male/unsexed; (Ref. 26130)); 8 cm (female)
  • Wischnath, L. 1993 Atlas of livebearers of the world. T.F.H. Publications, Inc., United States of America. 336 p. (Ref. 26130)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater; pH range: 7.0 - 7.8; dH range: 10 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Produces 20 to 50 young after about 28 days gestation.
  • Wischnath, L. 1993 Atlas of livebearers of the world. T.F.H. Publications, Inc., United States of America. 336 p. (Ref. 26130)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Poeciliopsis catemaco

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCTGGCATGGTAGGAACAGCTCTAAGCCTCTTAATCCGAGCTGAGCTAAGTCAGCCTGGCACCCTTCTGGGTGATGATCAAATTTACAACGTGATCGTCACAGCTCACGCCTTTGTAATAATCTTTTTCATAGTTATACCAATCATGATTGGCGGGTTTGGCAATTGACTAGTCCCACTAATAATCGGAGCTCCGGACATGGCCTTCCCCCGAATGAACAACATAAGTTTTTGACTTCTGCCCCCTTCATTCCTCCTTCTTTTGGCCTCATCAGGTGTAGAAGCGGGGGCCGGCACAGGATGAACTGTTTACCCCCCACTCGCAGGTAATCTAGCCCACGCAGGCCCTTCCGTGGACTTAACCATCTTTTCACTTCATTTAGCTGGTATTTCTTCTATCCTGGGGGCAATTAACTTTATTACTACCATCATTAATATGAAACCCCCAGCAGCATCCCTATACCAAACACCTCTGTTTGTGTGAGCAGTATTAATCACTGCCGTTCTTCTCCTTCTCTCCCTACCTGTCCTTGCCGCAGGGATCACTATGCTTCTCACAGATCGGAACCTAAATACCACTTTCTTCGACCCTGCCGGGGGAGGTGATCCAATTCTTTACCAACACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Poeciliopsis catemaco

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Wischnath, L. 1993 Atlas of livebearers of the world. T.F.H. Publications, Inc., United States of America. 336 p. (Ref. 26130)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!