Overview

Comprehensive Description

Carassius gibelio (Bloch, 1782)

Inland water: 24800-645 (2 spc.), 13.12.1982 , Ipsala , Edirne , Sinan Subakar ; 24800-880 (1 spc.), 28.10.1997 , Egridir Lake , M. Ôzulug ; 24800-633 (1 spc.), 31.07.1998 , Kayali Dam Lake , Kirklareli , M. Ôzulug ; 24800-634 (4 spc.), 25.04.1998 , Tunca River , Edirne , M. Ôzulug ; 24800-635 (3 spc.), 01.08.1998 , Sancaali Pond , Kirklareli , M. Ôzulug ; 24800-636 (1 spc.), 28.06.1998 , Coepkoey Pond , Edirne , M. Ôzulug ; 24800-637 (2 spa), 28.06.1998 , Buelbueldere Pond , Edirne , M. Ôzulug ; 24800-644 (7 spa), 01.08.1998 , Nazik Lake , Bitlis , Mahmut Elp ; 24800-712 (3 spc.), 07.06.2002 , Istanbul Tecnical University Pond , M. Ôzulug , C. Dalyan ; 24800-646 (10 spc.), 15.04.2001 , Bueytikcekmece Dam Lake , Istanbul , M. Ôzulug ; 24800-638 (1 spc.), 29.06.1998 , Ibriktepe Dam Lake , Edirne , M. Ôzulug ; 24800-643 (2 spc.), 30.08.2001 , Kinikli Stream , Istanbul , M. Ôzulug ; 24800-642 (1 spc.), 30.06.1998 , Kavakli Stream , Çanakkale , M. Ôzulug ; 24800-639 (5 spc.), 29.06.1998 , Meric River , Edirne , M. Ôzulug ; 24800- 641 (9 spa), 29.06.1998 , Camlica Creek , Edirne , M. Ôzulug ; 24800-640 (4 spc.), 29.06.1998 , Gala Lake , Edirne , M. Ôzulug .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 35-35, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits a wide variety of still water bodies and lowland rivers, usually associated with submerged vegetation or regular flooding. Can strongly tolerate low oxygen concentrations and pollution (Ref. 59043). Lake dwelling individuals move into river mouths to avoid low oxygen water in winter (Ref. 39176). Feeding larvae and juveniles occur in high-complexity habitats as reed belts. Feeds on plankton, benthic invertebrates, plant material and detritus. Spawns in shallow, warm shores on submerged vegetation (Ref. 59043). Able to reproduce from unfertilized eggs (gynogenesis) (Ref. 41851). Life span reaches up to about 10 years (Ref. 59043). Eastern European or wild form of the goldfish (Ref. 1739).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Europe, Russia and Asia; introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe and Asia: usually considered as native from central Europe to Siberia or introduced to European waters from eastern Asia. Clear and definite data on original distribution in Europe are not available due to introduction, confusion with Carassius auratus and complex modes of reproduction. At present, widely distributed and commonly stocked together with Cyprinus carpio which is transported throughout Europe. Absent in northern Baltic basin, Iceland, Ireland, Scotland and Mediterranean islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 450 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm SL (male/unsexed; (Ref. 59043)); max. published weight: 3,000 g (Ref. 556); max. reported age: 10 years (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosed from its congeners in Europe by having the following characters: body silvery-brown in color; last simple anal and dorsal rays strongly serrated; 37-52 gill rakers; lateral line with 29-33 scales; freed edge of dorsal concave or straight; anal fin with 5½ branched rays; and peritoneum black (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Amur River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; brackish; pH range: 7.1 - 7.5; dH range: 12; depth range 0 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Thelohanellus Infection 4. Parasitic infestations (protozoa, worms, etc.)
  • Wang, G.T., W.J. Yao, J.G. Wang and Y.S. Lu 2001 Occurrence of thelohanellosis caused by Thelohanellus wuhanensis (Mysoxporea) in juvenile allogynogenetic silver crucian carp, Carassius auratus gibelio (Bloch), with an observation on the efficacy of fumagillin as a therapeutant. J. Fish Dis. 24:57-60. (Ref. 47459)   http://www.fishbase.org/references/FBRefSummary.php?id=47459&speccode=6376 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black Spot Disease 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females spawn with several other species, for example Cyprinus carpio and Carassius carassius, but the eggs just develop without being actually fertilized resulting in a female only population (Ref. 2059). In Europe, populations considered as triploid and only females. But in some populations, it should be possible to find up to 25% of males which should be diploid (Ref. 40476). "There are also all-female populations in which all individuals are triploids. Triploids are sperm parasites of other cyprinid species such as Cyprinus carpio, Rutilus rutilus and Abramis brama. Older individuals spawn earlier in season than younger ones. Males move to spawning sites before females. Males follow ripe females, often with much splashing. Sticky eggs are attached to water plants or submerged objects" (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carassius gibelio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGTACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCTTTAAGCCTCCTCATCCGAGCTGAACTTAGTCAACCCGGATCACTTCTAGGTGATGACCAAATTTACAATGTAATTGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATCCTCATTGGAGGATTCGGAAACTGACTTGTGCCCCTGATAATCGGAGCCCCAGACATGGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTTCCCCCATCATTCCTGTTACTACTAGCTTCCTCTGGTGTTGAAGCCGGAGCTGGCACCGGATGGACAGTATACCCCCCTCTTGCAGGAAACCTAGCCCACGCAGGAGCATCAGTAGACCTAACAATTTTCTCACTACATTTAGCAGGTGTTTCATCAATCCTGGGGGCAATCAACTTCATTTCTACAACCATTAACATAAAACCTCCAGCCATTTCCCAATACCAAACACCCCTATTTGTTTGATCCGTACTTGTAACCGCCGTCCTCCTTCTCCTATCACTACCTGTTCTAGCTGCCGGTATTACAATGCTTTTAACAGATCGAAATCTTAACACCACATTCTTTGACCCCGCAGGCGGGGGAGACCCAATTCTCTATCAACACTTATTCTGATTCTTTGGTCACCCAGAAGTTTATATTTTAATCCTTCCAGGATTTGGAATTATTTCTCACGTTGTAGCCTATTATTCAGGTAAAAAAGAACCATTTGGTTATATAGGAATAGTATGAGCCATAATGGCCATTGGCCTCCTAGGGTTCATTGTATGAGCCCACCATATGTTTACCGTCGGAATGGACGTAGACACCCGTGCATATTTTACATCCGCAACAATAATCATCGCAATTCCAACGGGTGTAAAAGTATTTAGCTGACTGGCTACACTTCACGGAGGATCAATTAAATGAGAAACACCAATACTATGAGCCCTAGGGTTTATTTTCCTGTTTACAGTGGGAGGACTTACAGGAATTGTCCTCTCTAATTCATCACTTGATATTGTTCTCCACGACACCTATTATGTAGTAGCACATTTCCACTATGTACTATCAATGGGTGCCGTATTCGCAATTATGGCAGCCTTTGTACACTGATTCCCTCTACTAACAGGGTACACTCTACATAGCGCTTGGACAAAAATCCACTTTGGGGTTATATTTATTGGAGTTAACCTCACATTCTTCCCACAACACTTCCTAGGTCTAGCAGGAATACCACGACGGTATTCTGATTACCCAGACGCTTATGCCCTATGAAATACAGTATCATCTATCGGATCCCTAATCTCCTTAGTAGCGGTAATTATGTTCCTATTTATTCTATGAGAAGCCTTCGCCGCTAAACGAGAAGTGTTATCTGTAGAACTAACAATAACAAATGTGGAATGACTCCATGGCTGCCCCCCTCCTTACCACACATACGAGGAACCAGCATTTGTTCAAATTCAATCAAATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carassius gibelio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 55
Specimens with Barcodes: 155
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Prussian carp

The Prussian carp, silver Prussian carp or Gibel carp (Carassius gibelio, sometimes Carassius gibelio gibelio and, before 2003, Carassius auratus gibelio), is a member of the family Cyprinidae, which includes many other fish, such as the common carp, and the smaller minnows. It is a medium-sized cyprinid, and does not exceed a weight of 6.6 pounds (3 kg) and a size of 45 cm. They are usually silver, although other color variations exist. They are omnivorous and feed on plankton, invertebrates, plant material and detritus. Originally from Asia (Siberia), they have been introduced to and are now inhabiting lakes, ponds, and slow-moving rivers throughout Europe, North America, and Asia.[1][2][3][4][5]

Description[edit]

The Prussian carp is a deep-bodied, robust fish which resembles the Crucian carp (Carassius carassius) and grows to about 10 to 35 cm (4 to 14 in) in length. Its scales are larger than those of the Crucian carp, and it typically has 27 to 32 scales along the lateral line, whereas the Crucian carp usually has between 31 and 35. The species is silvery, sometimes with a faint golden twinge, while the Crucian carp has a burnished gold appearance. The Prussian carp's tail is more deeply forked than that of the Crucian carp. [6]

Domestication into Goldfish[edit]

A goldfish-like specimen showing yellow coloration
Wild Prussian carp with typical habitus and greenish color

Goldfish were originally developed from domesticated Prussian carp in China over 1,000 years ago, when they were bred for color for display in ornamental ponds and watergardens. Although some sources claim that crucian carp (Carassius carassius) are the wild version of the goldfish (Carassius auratus), recent research has found that the wild form of the goldfish is actually the Prussian carp (Carassius gibelio, or sometimes C. auratus gibelio, with gibelio identified as a subspecies of C. auratus). While they are certainly closely related, and often confused, they are different species, and can be identified by the following characteristics:[citation needed]

  • C. auratus has a more pointed snout, while the snout of C. carassius is well rounded.
  • The wild form of the goldfish (C. gibelio) often has a grey/greenish color, while crucian carps are always golden bronze.
  • Juvenile crucian carp (and tench) have a black spot on the base of the tail which disappears with age. In C. auratus, this tail spot is never present.
  • C. auratus fish have fewer than 31 scales along the lateral line, while crucian carp have 33 scales or more.
  • C. carassius has 28 to 29 fine denticles on the posterior edge of the last unbranched spiny ray of the dorsal fin, while C. auratus has 10 to 11 irregular denticles.

References[edit]

  1. ^ http://www.fishbase.org/summary/Speciessummary.php?id=6376
  2. ^ "Data Use Agreement - GBIF Portal". Data.gbif.org. 2007-02-22. Retrieved 2010-07-29. 
  3. ^ http://www.frammandearter.se/0/2english/pdf/Carassius_gibelio.pdf
  4. ^ "Nobel International Journals". Nobelonline.net. 2010-01-01. Retrieved 2010-07-29. 
  5. ^ "Journal Article". SpringerLink. Retrieved 2010-07-29. 
  6. ^ "Prussian carp: Carassius gibelio". NatureGate. Retrieved 14 December 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!