Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on or near the bottom of continental and insular slopes at depths from 275 to 1,000 m (possibly to 2,000 m); also oceanic in the south Atlantic from the surface to 710 m (Ref. 6871), possibly as deep as 1998 m (Ref. 58302). Feeds on fish eggs, lanternfish, squid, and other small dogfish (Ref. 5578). Ovoviviparous (Ref. 205). Utilized dried salted for human consumption and for fishmeal (Ref. 247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Widespread, but patchy distribution in the Atlantic, Pacific and Indian oceans.

Western Central Atlantic: northern Gulf of México (USA, México). Southwest Atlantic: northeastern Brazil (States of Rio Grande do Norte, Pernambuco and Alagoas), southern Brazil, through Uruguay to Argentina. Central south Atlantic: oceanic between Argentina and South Africa. Northeast, eastern central and southeast Atlantic: Portugal, Madeira, Azores, Canary Islands, Liberia, Cape Verde, Ivory Coast to Gabon, Zaïre, Angola and Namibia. Western Indian: South Africa. Eastern Indian: Australia (Tasmania). Southwest Pacific: Australia (New South Wales) and New Zealand. Northwest Pacific: Japan (southeastern Honshu) (Whitehead et al. 1984, Last and Stevens 1994, Cox and Francis 1997, Soto 2001, Compagno in prep. a).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: northern Gulf of Mexico; southern Brazil to Argentina (Ref. 247, 6871). One specimen collected off the Guianas (Ref. 13608). Eastern Atlantic: Portugal to Namibia. Also occurs in oceanic waters between Argentina and South Africa. Western Indian Ocean: South Africa, and Arabian Sea (Ref.85183). Western Pacific: Australia (Ref. 6871), New Zealand (Ref. 26346), and Japan. Southeast Pacific: Amber Seamount, Nasca and Sala-y-Gomez.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan, mostly in temperate seas (including Hawaiian Islands Chain).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 480 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 36731))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Bladelike unicuspidate teeth in lower jaw and teeth with cusps and cusplets in upper jaw, relatively short snout, low, truncated denticles (Ref. 247). Blackish brown dorsally, with an obscure broad black mark running above, in front and behind pelvic fins (Ref. 247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Etmopterus pusillus is found on or near the bottom of continental and insular slopes at depths of 150?1,000 m (possibly to 1,998 m); also oceanic in the Central South Atlantic from the surface to 710 m (Krefft 1980). In Moroccan waters, the species is subdominant and mainly occurs at depths of 400?600 m (Litvinov 1993). The species is very common in Sierra Leone waters at depths of 200?500 m (Litvinov 1993). In Cape Verde this species is frequently caught at Nova Holanda Seamount, Maio, Santo Antao, South Nocolau, and Sal, between 400?1,100 m, but usually from 650?750 m. In Suruga Bay, Honshu, Japan, mature and immature E. pusillus are segregated by depth. Immature sharks (16.5?32.7 cm TL) are captured by bottom trawl nets at depths of 150?411 m. Mature sharks (<42.3 cm TL) are captured on bottom longlines in deeper water (S. Tanaka pers. obs. 2007).

Very little is known about this species habitat, ecology and biology. Reproduction is aplacental viviparity. Total length (TL) at first maturity is 38?47 cm in females and 31?39 cm in males (Compagno in prep.). Data from off Portugal in the eastern Atlantic gives estimates of 38.1 cm TL for males and 43.6 cm TL for females (Coelho and Erzini 2005). Considering the observed maximum sizes of this population (47.9 cm for males and 50.2 cm for females), this species matures extremely late in its life cycle: 86.9% of the maximum size for females and 79.5% of the maximum size for males (Coelho and Erzini 2005). Size at birth (taken from final stage embryos) is 12.1?13.5 cm TL (Coelho unpublished data). Ovarian fecundity ranges from 8?18 eggs and uterine fecundity ranges from one to six embryos (Coelho unpub. data). In Suruga Bay, Honshu, Japan, female size at maturity is estimated at 47 cm TL and male size at maturity 38?41 cm TL (Shirai and Tachikawa 1993, S. Tanaka pers. obs. 2007).

Feeds on fish eggs, lanternfish, squid, and other small dogfish (Compagno in prep.). Off the coast of Namibia and South Africa, E. pusillus eats cephalopods, hake (Merluccidae, Merluccius spp.), lanternfish (Myctophidae, Diaphus), and small squaloid sharks (Compagno in prep.).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; oceanodromous (Ref. 51243); marine; depth range 0 - 1070 m (Ref. 26346), usually 400 - 700 m (Ref. 36731)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 128 specimens in 1 taxon.
Water temperature and chemistry ranges based on 86 samples.

Environmental ranges
  Depth range (m): 110 - 3650
  Temperature range (°C): 2.523 - 11.957
  Nitrate (umol/L): 6.721 - 40.998
  Salinity (PPS): 34.231 - 35.403
  Oxygen (ml/l): 0.888 - 5.911
  Phosphate (umol/l): 0.824 - 2.692
  Silicate (umol/l): 2.694 - 60.883

Graphical representation

Depth range (m): 110 - 3650

Temperature range (°C): 2.523 - 11.957

Nitrate (umol/L): 6.721 - 40.998

Salinity (PPS): 34.231 - 35.403

Oxygen (ml/l): 0.888 - 5.911

Phosphate (umol/l): 0.824 - 2.692

Silicate (umol/l): 2.694 - 60.883
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1070m.
Recorded at 1070 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on or near the bottom of continental and insular slopes at depths from 275 to 1,000 m (possibly to 2,000 m); also oceanic in the south Atlantic from the surface to 710 m (Ref. 6871). Benthopelagic at 200-1000 m (possibly to 1998 m) (Ref. 58302). Feeds on fish eggs, lanternfish, squid, and other small dogfish (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous (Ref. 247). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etmopterus pusillus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTTGGTGCATGAGCAGGCATAGTAGGCACAGCCTTAAGCTTACTTATTCGAGCAGAGCTAAGCCAACCGGGAACCCTTCTGGGGGATGATCAAATCTACAATGTTATTGTAACCGCCCATGCATTCGTAATAATCTTTTTTATAGTAATGCCAGTAATAATCGGCGGATTTGGGAACTGATTAGTACCTTTAATAATTGGTGCACCAGATATGGCTTTTCCACGAATAAATAACATAAGCTTTTGGCTACTACCACCCGCCCTCCTTCTACTTTTAGCCTCCGCCGGAGTTGAAGCAGGGGCCGGGACTGGTTGAACAGTTTACCCACCCCTTGCAGGAAATATGGCCCATGCCGGGGCATCTGTGGACTTAGCCATTTTTTCACTTCACTTGGCTGGCATCTCCTCAATTTTAGCCTCTGTTAATTTTATTACAACCATTATTAATATAAAACCACCTGCTATCTCTCAATATCAAACACCACTATTTGTCTGATCAATTCTTGTAACTACTGTTCTCCTCCTCCTTGCTCTTCCTGTACTTGCAGCTGCAATTACAATACTGCTTACAGACCGTAATTTAAACACAACATTCTTTGACCCTTCTGGTGGAGGCGATCCTATTTTATATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Etmopterus pusillus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Coelho, R., Tanaka, S. & Compagno, L.J.V.

Reviewer/s
Acuña, E., Valenti, S.V., Kyne, P.M. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
Etmopterus pusillus is a deepwater lantern shark that occurs in the Atlantic, Pacific and Indian Oceans, found on or near the bottom of continental and insular slopes at depths of 150?1,000 m, and possibly down to almost 2,000 m. The species is also oceanic in the central south Atlantic, and is found from the surface to 708 m depth over deepwater. Although E. pusillus is of little interest to global fisheries, it is a bycatch of bottom trawls operating in the eastern Atlantic and off Japan, fixed bottom nets, and line gear. It is discarded by fisheries off southern Portugal, but is probably a utilized elsewhere in the eastern Atlantic. In the Northeast Atlantic, although captures are still high and stable, very little is known about the biology and distribution of this deepwater species. More studies on this species? biology are needed; particularly considering that many deepwater squaloids have life characteristics that can make them especially vulnerable to depletion in fisheries. However, there is no evidence to suggest that this species has declined or faces significant threats. Furthermore it has a widespread geographic and bathymetric distribution and is therefore considered Least Concern at present. Expanding deepwater fisheries should be monitored and bycatch levels should be quantified to ensure that this species is not significantly impacted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Etmopterus pusillus is much less common than E. spinax, although it may occur within the same depth range off Morocco to Mauritania (Gulyugin et al. 2006). Catch per unit effort data are available from trawls conducted off Portugal in the eastern Atlantic, at depths of 84?786 m; abundance peaked at 400 m depth, with captures of 1.5 individuals per hour.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Although E. pusillus is of little interest to global fisheries, it is a bycatch of bottom trawls operating in the eastern Atlantic, fixed bottom nets, and line gear (Compagno in prep.). Although discarded by fisheries off southern Portugal, it is probably a utilized bycatch elsewhere in the eastern Atlantic. In Suruga Bay, Japan, this species is taken as bycatch by trawlnet fisheries and is usually discarded.

This species is captured in several fisheries off the southern Portuguese coast. Catch Per Unit Effort (CPUE) data for deep-water longlines set at 200?780 m depth have increased from 2.23 specimens of E. pusillus per 1,000 hooks (s.d.=2.72) in 1997?1998 (Erzini et al. 1999, Coelho et al. 2005) to 4.03 specimens per 1,000 hooks in 2003 (s.d.=2.30) (R. Coelho unpub. data). This represents an increase in CPUE of 80%. All samples were taken aboard commercial fishing vessels, where a number of variables cannot be standardized, namely the number of fishing days per specific depth, the number of fishing days per specific site, the number of fishing days per specific season, the size of the hooks and the bait used. Off southern Portugal, the species is also captured in high quantities as bycatch of the bottom trawl fishery that targets Norway Lobster (Nephrops norvegicus), Red Shrimp (Aristeus antennatus) and Deepwater Pink Shrimp (Parapenaeus longirostris), and by the near bottom longline fishery that targets European Hake (Merluccius merluccius), Conger Eels (Conger conger) and Wreck Fish (Polyprion americanus). Etmopterus pusillus are apparently discarded by all fisheries off southern Portugal, and therefore no landings data are available for these fisheries (Coelho et al. 2005).

Off the coast of western Africa (Namibia) in the southeast Atlantic, E. pusillus is caught occasionally in bottom and midwater trawls (Bianchi et al. 1999). The species is also presumably caught in deepwater trawls off Mauritania and Morocco as a result of the new silver scabbard deepwater longline fishery, which began in 2001, off Morocco (H. Masski pers. comm.).

Little information is available on the capture of this species in fisheries throughout the rest of its range, however these are not thought to pose a significant threat to the global population at present.

This species is utilized (dried-salted) for human consumption and for fishmeal in some areas (Compagno in prep.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Smooth lanternshark

The smooth lanternshark or slender lanternshark (Etmopterus pusillus) is a species of dogfish shark in the family Etmopteridae, found widely in the Atlantic and Pacific Oceans. It inhabits benthic environments at a depth of 274–1,000 m (899–3,300 ft), and pelagic environments at a depth of 0–708 m (0–2,323 ft). The smooth lanternshark forms a species group with the larger blurred lanternshark (E. bigelowi), both of which are distinguished from other members of their family by small, irregularly arranged dermal denticles with a truncated shape. This species has a slender, dark brown body with an indistinct black band on the sides over the pelvic fins, and reaches 50 cm (20 in) in length. This slow-growing, ovoviviparous shark feeds on smaller squid, fishes, and fish eggs. Smooth lanternsharks are often caught as bycatch in eastern Atlantic and Japanese commercial fisheries. The International Union for Conservation of Nature (IUCN) has evaluated this species as of Least Concern because of its wide distribution and limited threats.

Contents

Taxonomy and phylogeny

Early illustration of a smooth lanternshark, from A history of the fishes of Madeira (1843).

The first scientific description of the smooth lanternshark, as Acanthidium pusillum, was published by British biologist Richard Thomas Lowe, in an 1839 issue of the scientific journal Transactions of the Zoological Society of London. This species was later moved to the genus Etmopterus.[2] The specific epithet pusillus means "weak" in Latin.[3] The smooth lanternshark forms a species group with the blurred lanternshark (E. bigelowi); these two species are distinguished from other lantern sharks by their irregularly arranged, truncated (ending in a flat crown as though the tip were cut off) dermal denticles.[4]

Distribution and habitat

In the Atlantic Ocean, the smooth lanternshark occurs from the Gulf of Mexico to Argentina in the west, Portugal to South Africa (including Cape Verde and the Azores) in the east, and on the Mid-Atlantic Ridge.[5] In the Indian Ocean, it is found off KwaZulu-Natal and Madagascar. In the Pacific Ocean, it has been reported from the East China Sea to southern Japan, in the Hawaiian–Emperor seamount chain area, off Australia and New Zealand, and over the Nazca Plate (including the Amber Seamount and off Isla Salas y Gómez).[4][6]

Smooth lanternsharks are usually found on or near the bottom on continental and insular shelves and slopes at depths of 274–1,000 m (899–3,300 ft), and possibly to as deep as 1,998 m (6,555 ft).[7] Catch data off southern Portugal suggest this species has a preference for rocky substrates, and may conduct a diel vertical migration.[8] In the South Atlantic, this shark also inhabits the open ocean from the surface to a depth of 708 m (2,323 ft).[7] It has been observed swimming over fields of hydrothermal vents.[5]

Description

The smooth lanternshark has a bulbous snout and large oval eyes.

Lightly built, the smooth lanternshark has a large head with a pointed snout, large oval eyes, and nostrils with short anterior skin flaps. There are 22–31 tooth rows in the upper jaw and 30–53 tooth rows in the lower jaw. Each upper tooth has a narrow smooth-edged central cusp flanked by 1–2 tiny cusplets; mature males over 38 cm (15 in) long grow additional pairs of lateral cusplets with age. The lower teeth are smooth, knife-like, and angled, with their bases interlocking to form a continuous cutting surface. The five pairs of gill slits are long.[2][4]

The first dorsal fin bears a stout spine in front and originates over the free rear tips of the rounded pectoral fins. The second dorsal fin is much larger than the first and has a longer spine. The pelvic fins are low and angular, and there is no anal fin. The caudal fin is short and broad, with a well-developed lower lobe and a ventral notch near the tip of the upper lobe. The skin is covered by many widely spaced, small blocky denticles not arranged in regular rows, giving it a smooth appearance. The coloration is a uniform dark brown, with a faint black mark over the bases of the pelvic fins extending both forward and backward on the flank. The smooth lanternshark is very similar to but smaller than the blurry lanternshark, attaining a length of 50 cm (20 in). The two species differ in a number of anatomical characteristics, but can be most reliably distinguished by the number of turns in their spiral valve intestines (10–13 in E. pusillus versus 16–19 in E. bigelowi).[2][4]

Biology and ecology

Adult smooth lanternsharks have sexually dimorphic upper teeth.

The smooth lanternshark feeds on squid, lanternfishes, smaller dogfish sharks, and fish eggs.[2] This species is ovoviviparous, with the developing embryos being sustained by a yolk sac. Females produce an average of 10 young per reproductive cycle.[9] Males reach sexual maturity at a length of 31–39 cm (12–15 in), and females at a length of 38–47 cm (15–19 in).[2] The length at maturity varies with geographical region, with sharks in the western Atlantic maturing larger than those from off KwaZulu-Natal.[10] This species grows at a slow rate, with the body becoming relatively longer with age. Off southern Portugal, males live to at least 13 years of age, and females to at least 17 years.[4][9]

Human interactions

Large numbers of smooth lanternsharks, predominantly juvenile, are caught incidentally by commercial longline fisheries, and to a lesser extent in bottom trawls and fixed bottom nets, in the eastern Atlantic and off Japan. This species is one of the three most common sharks caught as bycatch in deepwater fisheries off southern Portugal, along with the velvet belly lanternshark (E. spinax) and the blackmouth catshark (Galeus melastomus).[2][8] Most captured smooth lanternsharks are discarded, although some may be sold dried and salted for human consumption or processed into fishmeal.[6] The smooth lanternshark's slow rates of reproduction and growth may render it vulnerable to population collapse under sustained fishing pressure.[8] However, catch rates currently show no evidence of this occurring, which, coupled with the smooth lanternshark's wide geographic range, has led to the IUCN assessing it as of Least Concern.[1]

References

  1. ^ a b Camhi, M.D., S.V. Valenti, S.V. Fordham, S.L. Fowler and C. Gibson (2009). The Conservation Status of Pelagic Sharks and Rays: Report of the IUCN Shark Specialist Group Pelagic Shark Red List Workshop. Newbury: IUCN Species Survival Commission Shark Specialist Group. p. 41. ISBN 978-0-9561063-1-5. 
  2. ^ a b c d e f Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. p. 82. ISBN 92-5-101384-5. 
  3. ^ Jordan, D.S. and B.W. Evermann (1896). The Fishes of North and Middle America: A Descriptive Catalogue of the Species of Fish-like Vertebrates Found in the Waters of North America, North of the Isthmus of Panama, Part 1. Government Printing Office. p. 55. 
  4. ^ a b c d e Shirai, S. and H. Tachikawa (May 3, 1993). "Taxonomic Resolution of the Etmopterus pusillus Species Group (Elasmobranchii, Etmopteridae), with Description of E. bigelowi, n. sp.". Copeia 1993 (2): 483–495. doi:10.2307/1447149. JSTOR 1447149. 
  5. ^ a b Desbruyères, D. and M. Segonzac (1997). Handbook of Deep-sea Hydrothermal Vent Fauna. Editions Quae. p. 223. ISBN 2-905434-78-3. 
  6. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2009). "Etmopterus pusillus" in FishBase. September 2009 version.
  7. ^ a b Compagno, L.J.V., M. Dando and S. Fowler (2005). Sharks of the World. Princeton University Press. p. 105. ISBN 978-0-691-12072-0. 
  8. ^ a b c Coelho, R. and K. Erzini (July 2008). "Effects of fishing methods on deep water shark species caught as by-catch off southern Portugal". Hydrobiologia 606 (1): 187–193. doi:10.1007/s10750-008-9335-y. 
  9. ^ a b Coelho, R. and K. Erzini (August 2007). "Population parameters of the smooth lantern shark, Etmopterus pusillus, in southern Portugal (NE Atlantic)". Fisheries Research 86 (1): 42–57. doi:10.1016/j.fishres.2007.04.006. 
  10. ^ Smith, J.L.B., M.M. Smith and P.C. Heemstra (2003). Smiths' Sea Fishes. Struik. p. 56. ISBN 1-86872-890-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!