Overview

Comprehensive Description

Biology

Inhabits bays, estuaries and protected coastal waters. Feeds primarily on shellfish, also on some finfish (Ref. 3821).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The southern puffer, Sphoeroides nephelus, has a brown body, paler below, adorned with a variety of darker and lighter spots and blotches and often pale tan rings and semicircles. Larger dark splotches along the lower sides are variable and dark slashes may occur on the lower cheek. A dark interorbital (between the eyes) bar and a distinctive dark spot at the axil of the pectoral fins are particularly useful in identifying specimens. mature, ripe males may be covered with small, bright red or orange spots (Shipps 1978). Hard spines are lacking and the usual ray count is: dorsal=7; anal=6; pectoral=14 (Hoese and Moore 1977 Robbins et al. 1986).As with other puffers, the small mouth is comprised of 4 teeth fused together to form a strong beak. Individuals lack scales (Hinchcliff 2004).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: northeastern Florida and northern Gulf of Mexico in the USA and the Bahamas to Campeche in Mexico and Lesser Antilles. Taxonomic status of populations from northern South America to Brazil uncertain.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Northeastern Florida, northeastern Gulf of Mexico, and Bahamas to Campeche and Lesser Antilles (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sphoeroides nephelus occurs from northeast Florida south through much of the Caribbean and into the eastern half or the Gulf of Mexico (Shipp and Yerger 1969). Hoese and Moore (1977) extends the distribution to the Chandeleur Islands and off Yucatan. Robins et al. (1986) notes that the taxonomic status of populations reported from northern South America to Brazil is uncertain. Southern puffers can be found throughout the India River Lagoon system.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 8; Analspines: 0; Analsoft rays: 7
  • Shipp, R.L. 2003 Tetraodontidae. Puffers. p. 1988-2006. In K.E. Carpenter (ed.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Atlantic. Vol. 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. (Ref. 53033)   http://www.fishbase.org/references/FBRefSummary.php?id=53033&speccode=1181 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern puffers commonly reach a length of 20 cm, although larger specimens up to 30 cm have been reported (Hoese and Moore 1977, Froese and Pauly 2008).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Upper side brown with large dark grey to black spots and light (pale blue or green in fresh specimens) irregular-shaped reticulations. Lower side with an irregular row of dusky to black rounded spots. The axil spot the most intense in the series. Sexually mature, ripe males sometimes covered with brilliant red or orange spots of about 1 mm in diameter (white in preserved specimen). No lappets on head or body (Ref 53033).
  • Shipp, R.L. 2003 Tetraodontidae. Puffers. p. 1988-2006. In K.E. Carpenter (ed.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Atlantic. Vol. 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. (Ref. 53033)   http://www.fishbase.org/references/FBRefSummary.php?id=53033&speccode=1181 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paralectotype; Type for Sphoeroides nephelus
Catalog Number: USNM 31427
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Earll
Locality: Indian R., Florida., Florida, United States, Atlantic
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3286, Pl. 264.; Goode, G. B. & Bean, T. H. 1882. Proceedings of the United States National Museum. 5 (297): 412.; Type: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3286, Pl. 264.; Goode, G. B. & Bean, T. H. 1882. Proceedings of the United States National Museum. 5 (297): 412.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype; Type for Sphoeroides nephelus
Catalog Number: USNM 31428
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): R. Earll
Locality: Indian R., Florida., Florida, United States, Atlantic
  • Lectotype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3286, Pl. 264.; Goode, G. B. & Bean, T. H. 1882. Proceedings of the United States National Museum. 5 (297): 412.; Type: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3286, Pl. 264.; Goode, G. B. & Bean, T. H. 1882. Proceedings of the United States National Museum. 5 (297): 412.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Type for Sphoeroides nephelus
Catalog Number: USNM 26570
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Stearns
Year Collected: 1880
Locality: Florida., Florida, United States, Atlantic
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3286, Pl. 264.; Goode, G. B. & Bean, T. H. 1882. Proceedings of the United States National Museum. 5 (297): 412.; Type: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3286, Pl. 264.; Goode, G. B. & Bean, T. H. 1882. Proceedings of the United States National Museum. 5 (297): 412.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

The distributions of Sphoeroides nephelus and the northern puffer, S. maculatus, overlap along the northern half of Florida (including northern portions of the IRL). These congeners are similar in appearance, although southern puffers lack the dark spots and diffuse gray bars characteristic of the northern puffer (Robins et al. 1986). Ray counts, interorbital distance, and habitat and ecology also aid in differentiation of the two species. Adult S. nephelus remain inshore whereas adult S. maculatus typically are collected offshore, and usually only juveniles of the two species are collected together (Shipp and Yerger 1969).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 0 - 11 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 1 - 46.5
  Temperature range (°C): 22.025 - 24.635
  Nitrate (umol/L): 0.672 - 1.707
  Salinity (PPS): 36.012 - 36.186
  Oxygen (ml/l): 4.519 - 4.860
  Phosphate (umol/l): 0.118 - 0.253
  Silicate (umol/l): 1.328 - 2.171

Graphical representation

Depth range (m): 1 - 46.5

Temperature range (°C): 22.025 - 24.635

Nitrate (umol/L): 0.672 - 1.707

Salinity (PPS): 36.012 - 36.186

Oxygen (ml/l): 4.519 - 4.860

Phosphate (umol/l): 0.118 - 0.253

Silicate (umol/l): 1.328 - 2.171
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Bays, estuaries, and protected coastal waters (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 11m.
Recorded at 11 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The diet of southern puffers consists primarily of crabs and molluscs which they crush and eat with their powerful fused teeth (Shipp and Yerger 1969). Some finfish are consumed as prey as well (Ship 1978, Froese and Pauly 2008). Predators: The ability of puffers to take in water to inflate their body size is an important adaptation to minimize the risk of predation (Shipp 1978), although some predation certainly occurs. Parasites: Corkum (1959) reported parasitic tremetodes of genera Bucephalus and Prosorhynchus living within the intestine of ladyfish collected from the Mississippi Gulf coast. Habitats: Sphoeroides nephelus is a primarily benthic inhabitant of bays, estuaries, and protected waters to a depth of 11 m, and is frequently encountered in and around seagrass beds (Sedberry and Carter 1993, Froese and Pauly 2008). The species may also occur in salt marshes (Nordlie 2003) and in protected reef environments. Sedberry and Carter (1993) note the presence in the rubble zone of a Belize a barrier reef lagoon they surveyed. Activity Time: Southern puffers are primarily active by day, settling into sand bottoms to rest at night (author's personal observation).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Hoese and Moore (1977) note that this species is the common puffer in the northeastern Gulf of Mexico, and it is common along the east coast of Florida as well.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction is sexual; sexes are separate and fertilization is external. Springer and Woodburn (1960) reported Sphoeroides nephelus is a fall spawner, but Shipp and Yerger (1969) suggest more continuous spawning at least from spring through fall and possibly year-round within southern portions of the range.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Developmental details are sparse for this species. Other tetraodontids lay demersal eggs that they attach to rock and coral surfaces and which hatch to release free-swimming larvae. Early development of southern puffers is likely similar.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Hoese HD. 1960. Biotic changes in a bay associated with the end of a drought. Limnology and Oceanography 5:326-336.
  • Froese R and D Pauly (Eds). 2008. FishBase. World Wide Web electronic publication. Available online.
  • Nordlie FG. 2003. Fish communities of estuarine salt marshes of eastern North America, and comparisons with temperate estuaries of other continents. Reviews in Fish Biology and Fisheries 13:281-325.
  • Abbott JP, Flewelling LJ, and JH Landsberg. 2008. Saxitoxin monitoring in three species of Florida puffer fish. Harmful Algae (in press at the time this species report was written)
  • Hinchcliff G. 2004. Field Guide For the Rookery Bay National Estuarine Research Reserve. Available online.
  • Landsberg JH, Hall S, Johannessen JN, White KD, Conrad SM Abbott JP, Flewelling LJ, Richardson RW, Dickey RW, Jester ELE, Etheridge SM, Deeds JR, Van Dolah FM Leighfield TA, Zou Y, Beaudry CG, Benner RA, Rogers PL, Scott PS, Kawabata K, Wolny JL, and KA Steidinger. 2006. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environmental Health Perspectives, Vol. 114:1502-1507.
  • Sedberry GR and J Carter. 1993. The Fish Community of a Shallow Tropical Lagoon in Belize, Central America. Estuaries 16:198-215.Shipp RL.1978. Tetraodontidae. In: Fischer W (ed.). FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 5. FAO, Rome.
  • Shipp RL and RW Yerger. 1969. Status, characters, and distribution of the northern and southern puffers of the genus Sphoeroides Copeia 1969:425-433.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphoeroides nephelus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGGTATTTGGTGCCTGAGCCGGAATAGTAGGGACGGCCCTAAGCCTCCTTATTCGGGCAGAACTAAGCCAGCCCGGCGCACTCCTAGGTGACGACCAAATTTATAATGTAATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGTGGCTTCGGAAACTGATTAATCCCACTTATAATCGGAGCCCCTGATATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTCTTACCCCCCTCTTTCCTTCTTCTGCTTGCCTCTTCGGGGGTAGAAGCCGGGGCCGGAACAGGATGGACCGTGTACCCCCCTCTAGCCGGGAATTTAGCACACGCAGGAGCCTCCGTAGACCTAACCATTTTCTCCCTCCATCTCGCAGGTGTCTCCTCAATCCTAGGGGCTATTAACTTTATCACCACAATTATTAATATGAAGCCCCCTGCCATTTCACAATACCAAACACCCCTGTTTGTGTGAGCCGTGCTTATTACTGCAGTCCTTCTTCTACTTTCCCTCCCCGTACTTGCAGCAGGTATCACAATGCTTCTTACAGACCGAAACCTAAACACCACCTTCTTTGACCCGGCAGGGGGAGGAGACCCCATCCTCTACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphoeroides nephelus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern puffer

Southern puffer, Sphoeroides nephelus, is a species in the family Tetraodontidae, or pufferfishes. It is found in the Caribbean Sea, and possibly further south on the coast of Brazil.[1]

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2013). "Sphoeroides nephelus" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: "Taxonomic status of populations from northern South America to Brazil uncertain" (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!